ID: 997001363

View in Genome Browser
Species Human (GRCh38)
Location 5:129766069-129766091
Sequence AGGTATCTGCAGACAATGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 381}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997001363_997001370 3 Left 997001363 5:129766069-129766091 CCTTCCATTGTCTGCAGATACCT 0: 1
1: 0
2: 2
3: 29
4: 381
Right 997001370 5:129766095-129766117 GACATGGTTGTAGACACAGATGG 0: 1
1: 0
2: 4
3: 14
4: 187
997001363_997001371 4 Left 997001363 5:129766069-129766091 CCTTCCATTGTCTGCAGATACCT 0: 1
1: 0
2: 2
3: 29
4: 381
Right 997001371 5:129766096-129766118 ACATGGTTGTAGACACAGATGGG 0: 1
1: 0
2: 0
3: 10
4: 146
997001363_997001372 5 Left 997001363 5:129766069-129766091 CCTTCCATTGTCTGCAGATACCT 0: 1
1: 0
2: 2
3: 29
4: 381
Right 997001372 5:129766097-129766119 CATGGTTGTAGACACAGATGGGG 0: 1
1: 0
2: 0
3: 13
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997001363 Original CRISPR AGGTATCTGCAGACAATGGA AGG (reversed) Exonic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
903782382 1:25829355-25829377 TGGTATCTGTAGCCAGTGGAGGG - Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905339286 1:37267201-37267223 AGCAATCTGGAGACAATGCAGGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905731507 1:40302042-40302064 AGGAAGGTGCAGACAAAGGATGG + Intronic
905803533 1:40860968-40860990 AGGTTGCTGAAGACACTGGATGG - Intergenic
905889422 1:41510292-41510314 AGGTAACTGCATACATGGGAAGG + Exonic
906054946 1:42908468-42908490 AGTTATCTGCCAATAATGGAGGG + Intergenic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
907390274 1:54153519-54153541 AGGTTGCTGCAGACAGTTGAGGG + Exonic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911320984 1:96413736-96413758 AGCTATCTGCAGAAAGTGGATGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911793289 1:102046076-102046098 GGCTATCTGCAGACATTGGGTGG - Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912055307 1:105589780-105589802 GGCAATCTGCAGAAAATGGAAGG + Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912671426 1:111630991-111631013 AGGGATCTGCAGAGATAGGAAGG + Intronic
912968869 1:114261541-114261563 AGGATGCTGCAGACAAAGGAGGG - Intergenic
913028050 1:114866039-114866061 TGGTATGTGCAAACAATGAATGG - Intronic
914792418 1:150889974-150889996 AGGTATCGGGAAGCAATGGAAGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920822427 1:209393443-209393465 GGTTATTTGCAGACAATGGAGGG + Intergenic
921473190 1:215572661-215572683 AGGTAATGGCAGACAATAGATGG + Intronic
921530600 1:216277845-216277867 AGGCATATCCAGGCAATGGAAGG + Intronic
921619818 1:217313135-217313157 AATTATCTGCAGACGATGGTAGG - Intergenic
922215553 1:223516747-223516769 AGGGATTTGCAGGGAATGGAAGG - Intergenic
924126459 1:240858111-240858133 TGGTATATTCATACAATGGAAGG - Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063771810 10:9212278-9212300 CGGTATGTGGAGTCAATGGATGG - Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1064940378 10:20727881-20727903 AGGCATCTGCAAACACAGGAGGG - Intergenic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065011821 10:21427803-21427825 ATGTAGCTGCAGTCAGTGGATGG + Intergenic
1065428771 10:25632416-25632438 AGCTATCTGCATAAAATGGGGGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1067923016 10:50479039-50479061 AGGTAACTGCAGACAAAGAAGGG - Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070719069 10:78744052-78744074 ACAAATCTGCAGAGAATGGAGGG - Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071547558 10:86539878-86539900 AGAAATCTCCAGACATTGGAAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072504618 10:96052749-96052771 AGGCATCAGCAGAAAAAGGAGGG - Intronic
1073614902 10:104983820-104983842 AGATATAGGCAGAGAATGGAGGG - Intronic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073938511 10:108664600-108664622 TGATATTTGCAGAAAATGGAAGG - Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074724522 10:116294567-116294589 AGGTAGCATCAGACAGTGGAGGG - Intergenic
1074863436 10:117530975-117530997 AGGGCTCTGCGCACAATGGATGG + Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1078752858 11:14181409-14181431 AGGTAGTTGGAGAAAATGGATGG - Intronic
1080693084 11:34575616-34575638 AGGTATATACATACAATAGATGG + Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG + Intergenic
1084709234 11:70833833-70833855 AGGTGGCTGCAGGCAGTGGAAGG + Intronic
1084787229 11:71449393-71449415 CGGTATCTGCAGCTAATGGTGGG - Intronic
1085269874 11:75263962-75263984 AGGTTTCAGAAGACACTGGAGGG + Intergenic
1085453824 11:76654818-76654840 AGGAAGCTGCAGGGAATGGAGGG + Intergenic
1085807619 11:79650770-79650792 AGGTATGTGGAGTCAGTGGATGG - Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088495578 11:110428799-110428821 AAGTATCTGCGGACAATGTATGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091127308 11:133111988-133112010 ATGGATCTACAGACACTGGATGG + Intronic
1091316840 11:134620194-134620216 AGGTCTCTGCAGTGAAGGGAGGG + Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093007409 12:14065093-14065115 AGGGATTTGCAGACCAAGGAGGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094819396 12:34212699-34212721 GGTTATCTGCAGATAATGGCAGG - Intergenic
1095095414 12:38145375-38145397 GGTTATCTGCAGATAATGGCAGG + Intergenic
1095708030 12:45258950-45258972 AAGTATCTTCAGAAAATGGTGGG + Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097051689 12:56227018-56227040 AGATATCTGCAGCCCATGGCTGG - Intronic
1097314961 12:58162032-58162054 AGGTATCTGCAGAAAAGGAGAGG - Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101486718 12:105171501-105171523 AGGTAGATGCAGACAAGGTAAGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102581386 12:113890402-113890424 AGGTGTCTGCAGCCAATCGGAGG + Intronic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103549332 12:121725319-121725341 AGCTCTCTGCAGACAGTGCAGGG - Intronic
1104258737 12:127163356-127163378 AGGTAGCTGCAAAAAAAGGAAGG + Intergenic
1105033330 12:132900520-132900542 AATTATCTGCAGACAATGTCAGG + Intronic
1107753883 13:43598582-43598604 AGGCATGTGCAGAGACTGGAGGG - Intronic
1109761729 13:66839274-66839296 AGATATCTAGAGACAATGTAAGG - Intronic
1110046944 13:70842837-70842859 AGGTCTCTGCAGAGGATTGAAGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111603851 13:90510878-90510900 TGGTATGTCCATACAATGGAAGG + Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1113119351 13:106909727-106909749 AGGTCACTGCAGACAATGCAAGG - Intergenic
1113819228 13:113200381-113200403 AGGTGTCTGCAGACAATTACAGG - Intronic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114484401 14:23054437-23054459 AGGTTTCTCCAGACACTGTAGGG + Intronic
1115929443 14:38474429-38474451 TGGGACCTGCAGATAATGGAGGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120803111 14:88714971-88714993 AGATATTTGCAGACAAATGATGG - Exonic
1120807646 14:88770233-88770255 AGGTAAGTGAAGACAATGGCAGG - Intronic
1121126515 14:91410694-91410716 AGGTATCTACAGTAAAGGGAGGG - Intronic
1122160228 14:99778527-99778549 AGGAATCTGCAGGAAGTGGATGG - Intronic
1126515182 15:49525616-49525638 AGGTATCTGTACACATTTGATGG - Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127468242 15:59266122-59266144 AGGTCTCTGCAGACATAGCAAGG - Intronic
1128136052 15:65264331-65264353 AGGTAGCTGCGACCAATGGATGG + Intronic
1129785723 15:78308917-78308939 AGGTATGTGCAGAGGATGGGAGG - Intergenic
1131557367 15:93411597-93411619 AGGTCTGTGTATACAATGGAAGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142739089 17:1920166-1920188 AATTATCTGCAAATAATGGAAGG + Intergenic
1145743943 17:27299181-27299203 AGGTATCTGCAGGCATTTGAGGG + Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151758389 17:76087547-76087569 AGGTATCTCCAGTCTGTGGAGGG - Intronic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155736960 18:29235909-29235931 AGGTATGTGGACACATTGGAGGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1157364445 18:47050966-47050988 TGGTGACAGCAGACAATGGAGGG + Intronic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158980407 18:62755192-62755214 ACGTATCTGCACAGAATGAAAGG - Intronic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1159949206 18:74467889-74467911 TGGTATATACAGACAACGGAAGG - Intergenic
1162883210 19:13676069-13676091 CAGTATCTGCAGACACTGGAAGG - Intergenic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925639746 2:5975953-5975975 AAGGAGCTGCAGACAATAGAGGG + Intergenic
926229304 2:10990684-10990706 AGGGACCTGCAGACACTGGCAGG + Intergenic
928360131 2:30655952-30655974 GGGTATCTGCAAACAGTGGGTGG - Intergenic
928521758 2:32095883-32095905 AGGTATAGGCAGATCATGGATGG + Intronic
935432171 2:102988027-102988049 ACATATGTGCAGACAATGGTAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935624999 2:105164640-105164662 AGGTCTCAGCAGAAAATAGATGG - Intergenic
937125341 2:119471767-119471789 AGGTATCAGAAGACAGAGGACGG + Intronic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939731770 2:145793491-145793513 AGGTTTTTGCAGAGACTGGAGGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940475561 2:154157942-154157964 AGGTATCAGCAAATAATGAAGGG - Intronic
940615933 2:156048272-156048294 TGGTATCTCCAGACACAGGAGGG + Intergenic
940882333 2:158959291-158959313 AGGAAACTGCAGACAGTAGAAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943706925 2:191045760-191045782 AACTATCTGCAGGCAATGTAAGG - Intronic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
944155158 2:196599994-196600016 AGGTATCCTCACAAAATGGAAGG + Intergenic
944520123 2:200557096-200557118 AGCCATCTGCAAACAGTGGAAGG + Intronic
944681088 2:202077326-202077348 AAGCATCTGAAGACGATGGAAGG - Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
947012729 2:225583361-225583383 AGGTATGTGCAGATAACGCACGG + Intronic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947700032 2:232225782-232225804 ATGTGTCTGCAGCCAATGAATGG + Intronic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1172503983 20:35447460-35447482 AGGTATTTGCAGCCCAGGGAAGG - Intronic
1176422631 21:6528195-6528217 AGCTTTCTGCAGACCATGGCAGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176870521 21:14080129-14080151 GGTTATCTGCAGATAATGGCAGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177965924 21:27726074-27726096 ATGTGTCAGCAGACAAGGGAAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1179698124 21:43136511-43136533 AGCTTTCTGCAGACCATGGCAGG - Intergenic
1180240709 21:46502941-46502963 ATGTACATTCAGACAATGGAAGG + Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1182066714 22:27436284-27436306 CAGAATCTGGAGACAATGGAAGG + Intergenic
1182070045 22:27457189-27457211 AGGTTTCTCCAAACAAGGGACGG - Intergenic
1182392173 22:30007585-30007607 CAGTATCTGCAGACCATGGCAGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949196863 3:1321114-1321136 AGGTAACTGAAGACATGGGATGG - Intronic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949854660 3:8450428-8450450 AGGTATCTATAGACATTGAATGG - Intergenic
950002453 3:9667694-9667716 AGGTAGCAGCAGACAAGGGGTGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951393157 3:22131544-22131566 ATGTATCAGGAGAGAATGGAAGG + Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
953055043 3:39381320-39381342 ATTTATCTGCAGTCAAGGGAAGG - Intergenic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
955372898 3:58368877-58368899 AAGAATGTGTAGACAATGGAAGG + Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
960807349 3:121597032-121597054 AGGTGTGTGCAGGCAGTGGAAGG - Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964396800 3:156254347-156254369 AGGGATCTGCACAGAGTGGATGG - Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965066534 3:163857411-163857433 AGGAATCTGGATACAAGGGAGGG - Intergenic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
969215789 4:5721292-5721314 TGATATATGCAGACATTGGAAGG + Intronic
969508761 4:7605188-7605210 TGGGATATGCAGACAATGGCTGG - Intronic
970941614 4:21640944-21640966 AGTTATCTGCAGAGAGTGGCAGG - Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
972986539 4:44772633-44772655 AGGAAACTGCAGACATTGCATGG - Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
976028803 4:80725429-80725451 AAGTATCTCCAGACATTTGAAGG - Intronic
977384833 4:96325665-96325687 TGGTATCTGCAGAAAACAGAGGG + Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
979104150 4:116663490-116663512 TGGTATGTCCAGACAATGGAAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982354484 4:154451268-154451290 AGTTGTCTGCAGAGAATGGCAGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983339033 4:166434439-166434461 AGTTATCTGCAGAGAATGGAAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987577066 5:19743575-19743597 AAAGATCTGCAGACAATGGCAGG - Intronic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
990254636 5:53954288-53954310 AGGTATTTGCAGATGATGGATGG - Intronic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991238920 5:64433744-64433766 ATGTATCTGGAAACAATGGTGGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993280434 5:85919445-85919467 AGGTACCAGCAGACATTGGCAGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996505385 5:124262564-124262586 AGGCACCTGCAGACAATGCCGGG - Intergenic
997001363 5:129766069-129766091 AGGTATCTGCAGACAATGGAAGG - Exonic
997349082 5:133217307-133217329 GGGTATCTGCAGTCAATGTCCGG - Exonic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
998881906 5:146653615-146653637 AAATCTCTGCAGACAATGCACGG - Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000530257 5:162410547-162410569 AGGCATGTGCAGAGACTGGATGG - Intergenic
1000889630 5:166787092-166787114 AGGAATCTGCAGAAAAAGAAAGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002095025 5:176825516-176825538 TGGAATCTGCAGAGCATGGAAGG + Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1004162403 6:13226261-13226283 AGCTCTTTGCAAACAATGGAAGG + Intronic
1004251268 6:14024918-14024940 AGGTTTCTGCAGACACTGACAGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005252279 6:23961297-23961319 GGGTATCTGTGGACAATGAAGGG - Intergenic
1005312820 6:24574917-24574939 ATGCTTCTGCACACAATGGAAGG + Intronic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007488523 6:42199409-42199431 ATGTATCTTCAGAAAATGGCAGG + Intergenic
1007731243 6:43948639-43948661 AGGTAGATCCACACAATGGAAGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010396634 6:75400490-75400512 AGGTACCTGAATAGAATGGAGGG + Intronic
1010544410 6:77132347-77132369 AAGGGTCTGCAGATAATGGAAGG + Intergenic
1010612711 6:77974377-77974399 AGGTTTTTGCAGACAATATATGG - Intergenic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1012051840 6:94355925-94355947 AGGTATCTACAGTGAATAGAAGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015265205 6:131284730-131284752 AGGTTTATGAAGAAAATGGAAGG + Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015501514 6:133938489-133938511 AGACATCAGAAGACAATGGAGGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016576261 6:145572615-145572637 AGTTATCTGCAGAAAACGGCAGG + Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018461155 6:163999817-163999839 AGGTTTCGGCAGAAAATGCAAGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1027625098 7:80534591-80534613 AGCTATCTGCAAGCCATGGATGG - Intronic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1027859356 7:83556193-83556215 AGGTAAGTGCAGGCAGTGGAGGG - Intronic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028198356 7:87933577-87933599 AGGTCTCTGCAGGTAATAGAGGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030968743 7:116027126-116027148 AGTTCTCTGCAGACATTGGCAGG + Intronic
1031621789 7:123942620-123942642 AGGTATCTGCAGGCACAGGCTGG - Intronic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1033145828 7:138869385-138869407 AGGTCTCTGAAGACAGTTGAAGG - Intronic
1034915076 7:155031963-155031985 TGGTATATCCATACAATGGAAGG + Intergenic
1034924875 7:155113155-155113177 AGAAAACTGCAGACAGTGGAAGG + Intergenic
1035722100 8:1799602-1799624 AGGTTTCAGCAGGAAATGGATGG + Intergenic
1036392496 8:8336363-8336385 AGGTTTTTGCAGGGAATGGATGG - Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037992206 8:23328972-23328994 TGGAATCTGCAGACTTTGGAGGG - Intronic
1038462084 8:27725797-27725819 AGGCATCTGCGGACAGAGGATGG - Intergenic
1041400651 8:57440816-57440838 AGGTATCTTGAGATACTGGATGG + Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1049641105 8:143716396-143716418 AGGTATCTCCGGACAATGCGAGG - Exonic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052459831 9:28747990-28748012 AGGTATCTGCATACCACAGAAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056053216 9:82791798-82791820 AGCCATCTGAAGACAATGTAAGG - Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056658485 9:88527704-88527726 AGGTTCCCGCAGACCATGGAGGG - Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058241103 9:102561200-102561222 AGGTAAGTGCAAAAAATGGATGG - Intergenic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058999113 9:110329904-110329926 AAGTATTTGCAGGAAATGGAAGG + Intronic
1060364054 9:122990970-122990992 AGTTATCTGCATACATTGGAAGG + Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1062605289 9:137345036-137345058 GGGGATCTCCAGACAGTGGAAGG - Intronic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189061084 X:37754401-37754423 AGGGATCTGCATGCAGTGGAAGG - Intronic
1190255269 X:48757773-48757795 AGTTATCTGCAGAGAATAGCAGG - Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194649419 X:96497840-96497862 AGTTATCTGTAGATAATGGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196286197 X:113883153-113883175 AGGGATCTGTAGACCCTGGAAGG + Intergenic
1196903626 X:120410611-120410633 AGGAATCTGGATACAAGGGAGGG + Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197520957 X:127495499-127495521 AGGTATCTGCACACTATTGGGGG + Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200285116 X:154813846-154813868 AGGTATTTGCAGACATAGGCTGG - Intronic
1201765801 Y:17572653-17572675 GGTTATCTGCAGATAATGGCAGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1201835751 Y:18333336-18333358 GGTTATCTGCAGATAATGGCAGG + Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic