ID: 997007414

View in Genome Browser
Species Human (GRCh38)
Location 5:129834420-129834442
Sequence GTGGGAAAGGCCGTCATTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997007414_997007418 -3 Left 997007414 5:129834420-129834442 CCACTAATGACGGCCTTTCCCAC No data
Right 997007418 5:129834440-129834462 CACTTCGTTCTGTGCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997007414 Original CRISPR GTGGGAAAGGCCGTCATTAG TGG (reversed) Intergenic
No off target data available for this crispr