ID: 997013186

View in Genome Browser
Species Human (GRCh38)
Location 5:129903848-129903870
Sequence TCTCTAGTCGGTCACTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997013186_997013193 19 Left 997013186 5:129903848-129903870 CCTGACAAGTGACCGACTAGAGA No data
Right 997013193 5:129903890-129903912 GCGGTAAGAACAACGTGGAAAGG No data
997013186_997013192 14 Left 997013186 5:129903848-129903870 CCTGACAAGTGACCGACTAGAGA No data
Right 997013192 5:129903885-129903907 TGGCAGCGGTAAGAACAACGTGG No data
997013186_997013190 -6 Left 997013186 5:129903848-129903870 CCTGACAAGTGACCGACTAGAGA No data
Right 997013190 5:129903865-129903887 TAGAGAGAGAAGGCGCGGAGTGG No data
997013186_997013191 0 Left 997013186 5:129903848-129903870 CCTGACAAGTGACCGACTAGAGA No data
Right 997013191 5:129903871-129903893 GAGAAGGCGCGGAGTGGCAGCGG No data
997013186_997013194 23 Left 997013186 5:129903848-129903870 CCTGACAAGTGACCGACTAGAGA No data
Right 997013194 5:129903894-129903916 TAAGAACAACGTGGAAAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997013186 Original CRISPR TCTCTAGTCGGTCACTTGTC AGG (reversed) Intergenic
No off target data available for this crispr