ID: 997013190

View in Genome Browser
Species Human (GRCh38)
Location 5:129903865-129903887
Sequence TAGAGAGAGAAGGCGCGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997013186_997013190 -6 Left 997013186 5:129903848-129903870 CCTGACAAGTGACCGACTAGAGA No data
Right 997013190 5:129903865-129903887 TAGAGAGAGAAGGCGCGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997013190 Original CRISPR TAGAGAGAGAAGGCGCGGAG TGG Intergenic
No off target data available for this crispr