ID: 997015507

View in Genome Browser
Species Human (GRCh38)
Location 5:129929785-129929807
Sequence TGAAAATCTCTATGGATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 331}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997015507 Original CRISPR TGAAAATCTCTATGGATAAA TGG Intronic
900765076 1:4499540-4499562 TGAAAATCTCTAGAGACAGAAGG - Intergenic
901349949 1:8585902-8585924 TGAAAATCTCAAGGAATTAATGG + Intronic
904855636 1:33496356-33496378 TGAGAATCCCTAAGGATTAAAGG + Exonic
905304248 1:37006617-37006639 TGTAAATCCCTCTGGACAAAGGG + Intronic
905417128 1:37811756-37811778 TGAAGATCTCTCTGAGTAAAAGG - Exonic
908862793 1:68508372-68508394 AGCAAATATCTACGGATAAAAGG - Intergenic
909224963 1:73007754-73007776 TTAAAATATCTATTAATAAAGGG - Intergenic
909336270 1:74478551-74478573 TGAAATCCTCTATGAAAAAAAGG + Intronic
909669802 1:78175743-78175765 TGAAAATCTCATTAGAGAAATGG + Intergenic
912338388 1:108885866-108885888 TGAAAATCTTTGGGGCTAAAAGG + Intronic
914346880 1:146807498-146807520 TGAGAATCCCTATGGAAAATTGG - Intergenic
914450149 1:147784447-147784469 AGAAGATTTCTATGGGTAAATGG + Intergenic
915233421 1:154463133-154463155 TGAACATCTTTGTGCATAAAGGG + Intronic
918241972 1:182628708-182628730 TAAAAAGCTCTAAGCATAAAAGG - Intergenic
918694061 1:187520893-187520915 TATAACTCTCTATGGTTAAATGG + Intergenic
918855725 1:189754582-189754604 CGTAAATCTCTAGGAATAAAAGG - Intergenic
919347871 1:196409298-196409320 TGAAAACCTGTATGATTAAATGG - Intronic
920286801 1:204885434-204885456 AGAAAATCTGTGTGGCTAAATGG + Intronic
921659225 1:217779042-217779064 GGAAAATATATATGTATAAATGG + Intronic
921847256 1:219897397-219897419 TGAAAATCTACAGGGAAAAAAGG - Intronic
923578311 1:235182241-235182263 AGAAAATCTCTACGGACAACTGG - Exonic
924920230 1:248621310-248621332 TAAAAACCTCTTTGGAAAAATGG - Intergenic
1064834268 10:19507790-19507812 TGAAAATGTATGTGAATAAATGG + Intronic
1065028390 10:21561074-21561096 TTAAAATCTCTGTGCATAAAAGG - Intronic
1065914295 10:30339730-30339752 TTAATATCTCTATAAATAAATGG - Intronic
1068001665 10:51341988-51342010 TAATAATCCCTATGTATAAAGGG - Intronic
1068387768 10:56353988-56354010 TGAATATCTCTAAAAATAAATGG - Intergenic
1069245909 10:66205778-66205800 TGACAGGCTTTATGGATAAATGG - Intronic
1069264513 10:66441381-66441403 TAAAAATTTCTCTGGAGAAAAGG + Intronic
1071390258 10:85166972-85166994 TAAAAATATCTATGTATTAATGG + Intergenic
1071617479 10:87088845-87088867 AGAAAATCTTTAAAGATAAATGG + Intronic
1072070353 10:91909221-91909243 AGAAAATCTCAATGCATACATGG - Intronic
1073527905 10:104202759-104202781 TTAAAATATCTATGGAGAATAGG - Intronic
1074238767 10:111614325-111614347 GGAAAAGCTCTATGGCTAACAGG + Intergenic
1074704312 10:116117744-116117766 TGGAAAACTGAATGGATAAATGG + Intronic
1076415369 10:130283418-130283440 AGAAAAACCCTATGGATAGAGGG - Intergenic
1079641851 11:22815598-22815620 TCAAAATCTTTGTGCATAAAAGG + Intronic
1080071641 11:28095835-28095857 TGAAAATTTTTGTGGATACAGGG - Intronic
1080255604 11:30287474-30287496 TGAAACCTTCTATGGATACATGG + Intergenic
1081228026 11:40549065-40549087 TTAAAATATCTATGGCTAAATGG + Intronic
1082191048 11:49245529-49245551 GAAAAGTCTCTATGGCTAAAGGG - Intergenic
1082923113 11:58517318-58517340 TTAGAATGTCTATGGACAAATGG - Intergenic
1085864542 11:80274005-80274027 TGAAACTCACTCTGGATATAAGG + Intergenic
1086675071 11:89595495-89595517 GAAAAGTCTCTATGGCTAAAGGG + Intergenic
1090809617 11:130225242-130225264 TGAACACCTTTATGGACAAAGGG - Intergenic
1092565850 12:9664734-9664756 TCAAGATCTATATGAATAAAAGG - Intergenic
1093296242 12:17395617-17395639 TGGAAATCTTCCTGGATAAATGG + Intergenic
1093707620 12:22292099-22292121 TGAAAATCTCATTGTCTAAATGG - Intronic
1094302244 12:28978099-28978121 AGAAAATCACTATGGTTTAAGGG + Intergenic
1094305474 12:29014570-29014592 TGAAAATCTGTATGAACATAAGG - Intergenic
1094685968 12:32715055-32715077 TGACAATATCTATGGCTCAAGGG - Intronic
1096877762 12:54644001-54644023 TGAAGATCTCCATGGAAGAAGGG - Intergenic
1097500552 12:60395317-60395339 AGAAATTCTCGATGGAAAAAAGG - Intergenic
1099455851 12:82861987-82862009 TGAAATTCTCATTGTATAAAGGG - Intronic
1100109805 12:91226597-91226619 TGAATATCTTAATGGATAAATGG - Intergenic
1101765223 12:107691763-107691785 TGAACATCTAGATGGAAAAATGG - Intronic
1101946193 12:109139381-109139403 AGAAAATCTGTAAGGAGAAAAGG - Exonic
1102296004 12:111737146-111737168 AGAAAATATTTATGGACAAATGG - Intronic
1103283580 12:119781121-119781143 TGAAAAACTATGTTGATAAAAGG + Intronic
1106464912 13:30004823-30004845 TGAAAAGCAGTATGGAAAAAAGG - Intergenic
1107211555 13:37862363-37862385 TGGTAATATCTATGTATAAAAGG + Intronic
1107261973 13:38503179-38503201 TCAAAATATCTATAGATATAAGG + Intergenic
1107263406 13:38522084-38522106 TGAAAATATCTATGGATTTGGGG + Intergenic
1107264648 13:38538663-38538685 TGAAAATCTCTATTGGTCACTGG - Intergenic
1108811769 13:54234206-54234228 TGAAAATTCCTATAGAAAAATGG - Intergenic
1109758168 13:66789162-66789184 ACAAAATCTCTATGGATTATGGG + Intronic
1110195933 13:72788489-72788511 TGAAAATAGCTAAGGTTAAAAGG - Intronic
1111567971 13:90041710-90041732 TGGAATTCTCTGTGGATAACGGG + Intergenic
1111598611 13:90442978-90443000 GGAAAATCTGTATGGCTATAGGG - Intergenic
1111711872 13:91826544-91826566 TAAAAATCTATATGGACATATGG + Intronic
1111965122 13:94853222-94853244 TGAATATCAATATGGAAAAATGG + Intergenic
1116170093 14:41389803-41389825 TGAAAATCTAGAAGGATAAAGGG + Intergenic
1116289014 14:43007881-43007903 TGAAAAATTCTATAGATAGAGGG + Intergenic
1118549617 14:66935784-66935806 TCAAAATCCTCATGGATAAAAGG - Intronic
1119810079 14:77510425-77510447 TGAGAATCTTTACCGATAAAAGG + Exonic
1120265799 14:82249139-82249161 TGAAAAACTCAACTGATAAAAGG - Intergenic
1120273535 14:82344399-82344421 TGAATAACTGTATGGATATATGG + Intergenic
1120407558 14:84107585-84107607 TGAATATTTCTATTAATAAATGG + Intergenic
1120408915 14:84125939-84125961 TGAAAATCTGTAAGTTTAAAAGG + Intergenic
1120458731 14:84766050-84766072 TGAAAACCTCTGTGCATCAAAGG + Intergenic
1120657018 14:87203051-87203073 TAAAAATCTCTAGGAATAAAAGG + Intergenic
1121109342 14:91302041-91302063 TGGAGATCTGGATGGATAAAAGG + Intronic
1121308918 14:92924214-92924236 TGAACAGCCCTATGAATAAAGGG + Exonic
1121694242 14:95899904-95899926 TTAAAATATCTATGGTTTAATGG - Intergenic
1125078276 15:35646598-35646620 TAAAAATCTATATGGACTAAGGG - Intergenic
1125585892 15:40819673-40819695 TGAAAATCTCAACAGAAAAATGG - Intronic
1126548432 15:49899450-49899472 TAAAAATGTCAATGGATGAATGG + Intronic
1126718219 15:51545861-51545883 TGCAAAACACTATGGAAAAAAGG + Intronic
1126824458 15:52535388-52535410 TGAAAGTCTCCTTGGAGAAATGG - Intergenic
1126893615 15:53234247-53234269 TGAAAAGCTGCATGGATAAAAGG - Intergenic
1128348415 15:66871316-66871338 AGAAAATTACTAGGGATAAAAGG + Intergenic
1128808034 15:70548231-70548253 TGAAAAACTCTACAGATTAAGGG + Intergenic
1129500054 15:76027185-76027207 TGTGAGTCTTTATGGATAAAGGG - Intronic
1129957216 15:79649955-79649977 TTAAAATCTCAATTTATAAAAGG + Intergenic
1130560487 15:84954360-84954382 TTGAAATCTTTATAGATAAATGG - Intergenic
1131022584 15:89111849-89111871 TGAAAATATCAATAAATAAAAGG + Intronic
1134368732 16:13603949-13603971 AGAAAATCTCCATGTATATATGG - Intergenic
1138012457 16:53395505-53395527 TGAAAAACTCTATATCTAAATGG + Intergenic
1139114216 16:63929542-63929564 TAAAAATCTGTATTTATAAAAGG + Intergenic
1139987101 16:70907772-70907794 TGAGAATCCCTATGGAAAATTGG + Intronic
1141004703 16:80341206-80341228 TGAAAAGAGCTATGGATAAAGGG + Intergenic
1143299091 17:5896070-5896092 TGAAAACTACTATGGATGAATGG + Intronic
1143299095 17:5896129-5896151 TGAAAACAGCTATGGATAAATGG + Intronic
1143399271 17:6631813-6631835 TCAAAGTCTCCTTGGATAAATGG + Intronic
1144130275 17:12239977-12239999 TGATAATCTCAATAGATACAGGG - Intergenic
1144388869 17:14775205-14775227 TAAAAATCTCTGGGGATAAAAGG - Intergenic
1146190345 17:30760063-30760085 TCAAAATGTTTATGCATAAAAGG - Intergenic
1146246625 17:31290053-31290075 TAAAATTCTCAATGAATAAATGG - Intronic
1146335516 17:31966697-31966719 TCAAAATGTTTATGCATAAAAGG - Intronic
1147630592 17:41928374-41928396 TGTAAATATATATGGATTAATGG - Intronic
1148769513 17:50058843-50058865 TGAAAGTCTCTTTGGAAAAGTGG + Intronic
1149967223 17:61176959-61176981 TGCAAATCTCTAAGGACTAACGG - Intronic
1150462755 17:65366244-65366266 TTAAAATCACTAAGGAGAAATGG - Intergenic
1150958820 17:69892224-69892246 TGATAATCTCTAGGAATGAAAGG - Intergenic
1154077227 18:11215297-11215319 TGAAAGTCTGTCTGTATAAAGGG + Intergenic
1155455650 18:26009666-26009688 TGAAAATCTATGTGGATGGATGG + Intergenic
1157052180 18:44179193-44179215 TGAAAGTCTTTATGGAAAGAAGG - Intergenic
1157662572 18:49459049-49459071 TGAACTTTTCTATGGTTAAAAGG + Intronic
1158115953 18:53995540-53995562 TGAAAATGTCAAAGGAGAAAAGG - Intergenic
1158289462 18:55923009-55923031 TGTGGATCTCTATGGATATAGGG + Intergenic
1158803875 18:60946300-60946322 TGAAAAACTGTAGGGATAAAAGG - Intergenic
1158808972 18:61008951-61008973 TGAAAATTACTATGGATTAAGGG - Intergenic
1160258747 18:77270722-77270744 TTAATAACTCTCTGGATAAAAGG + Exonic
1161741555 19:6024079-6024101 TTAAAATGTCTATGGGAAAATGG - Intronic
1161787849 19:6339177-6339199 TAAAAATCTCTTTTTATAAAGGG + Intergenic
1165524340 19:36340880-36340902 TGAAAAGCTCTATGAATGTAAGG - Exonic
1165530272 19:36393652-36393674 TGAAAAACTCTATGAATGTAAGG - Exonic
1165569048 19:36759738-36759760 TGTAATGTTCTATGGATAAAGGG + Intronic
1166348499 19:42182006-42182028 TTATAATCTCTGAGGATAAAGGG + Intronic
1168022070 19:53616414-53616436 TGAACATCCATATGGAAAAAAGG - Intergenic
1168633909 19:57979719-57979741 AGAAAAACTCTATGAATATAAGG - Exonic
925489252 2:4373849-4373871 TGAATAGATCGATGGATAAATGG - Intergenic
926398761 2:12473126-12473148 TGAGAATTTCTATCTATAAATGG + Intergenic
929063995 2:37954173-37954195 CGAAAACTTCTATGGATCAAAGG - Intronic
929332517 2:40700828-40700850 TGAAAATCTTTTAGGAAAAATGG + Intergenic
930372980 2:50527984-50528006 TGAAAATCTGAAAGGATATAAGG - Intronic
930406553 2:50964678-50964700 TGATAATCTCTATAGAAAATTGG - Intronic
931010734 2:57910232-57910254 TGAAAATCTGCATGGAGAAAGGG - Intronic
931052942 2:58434396-58434418 TGAAACTTTCTATGGCAAAATGG - Intergenic
932397858 2:71460453-71460475 GGAAAATTTCTGTGGATGAAGGG + Intronic
932539158 2:72633458-72633480 TCAAAATCTTGATGGATATAGGG - Intronic
932830095 2:74980958-74980980 TGTAACTCTCCATGGAGAAATGG - Intergenic
933179332 2:79212028-79212050 TGAAAAACTAAATGGATTAAAGG + Intronic
933480925 2:82856098-82856120 AGAAAATTTATATGTATAAATGG - Intergenic
933919793 2:87033747-87033769 TGAACATCACTATGGCAAAAGGG + Intergenic
933928183 2:87120481-87120503 TGAACATCACTATGGCAAAAGGG + Intergenic
933931835 2:87160039-87160061 TGAACATCACTATGGCAAAAGGG - Intergenic
934003201 2:87736146-87736168 TGAACATCACTATGGCAAAAGGG - Intergenic
934107855 2:88712458-88712480 TGTAATTCTGAATGGATAAATGG + Intronic
934570013 2:95364271-95364293 TGAAAATCTTAATGCAGAAAGGG - Intronic
935061981 2:99616221-99616243 TGAAAATATATATGAATAAATGG - Intronic
935376436 2:102403403-102403425 TCAAAATCTCTGTAGAGAAATGG - Intergenic
935977080 2:108588710-108588732 TGAAACTCTCTATGCAGAAAGGG + Intronic
936686689 2:114836136-114836158 GGAAAATCTTTATTGAGAAAGGG - Intronic
936860705 2:117015565-117015587 TGAAAATGTATATATATAAAAGG - Intergenic
936877299 2:117206116-117206138 GGAAAGTCTCTAAGGAGAAAAGG + Intergenic
937366993 2:121270053-121270075 TGAAAATCTCACTAGAAAAATGG + Intronic
937515874 2:122654847-122654869 TGAAAATCTTCAAGGATAGAAGG - Intergenic
937522325 2:122726686-122726708 GGAAAATCTCTAAGGATGAAGGG - Intergenic
938762515 2:134438697-134438719 TGAAAATCACCATGAATATAAGG + Intronic
939286586 2:140138778-140138800 TGATATTCTTTAAGGATAAATGG - Intergenic
940428847 2:153563735-153563757 GGAAAACTTCTATGAATAAATGG - Intergenic
941759060 2:169220817-169220839 GGAACATTTTTATGGATAAAAGG + Intronic
942369555 2:175268245-175268267 TGAAAATATTTATGAACAAATGG + Intergenic
942417960 2:175778436-175778458 TGAAAATCATGATGGAAAAAGGG + Intergenic
943803819 2:192096248-192096270 TGAAAATCTCTTTATATAAAAGG - Intronic
943968515 2:194370789-194370811 TCAAGATCTCTCTGGTTAAATGG + Intergenic
944036199 2:195297390-195297412 TGAGAGTCTCTATTGGTAAATGG + Intergenic
944395759 2:199264179-199264201 TTAAAATCTTTAAGGATAAAGGG - Intergenic
945600057 2:211850324-211850346 TGAATATGTATATGAATAAAAGG - Intronic
945608020 2:211961099-211961121 TGAAAGTCTTTATGAATTAATGG + Intronic
946538553 2:220658312-220658334 ACAAGATCTCTATGGATAGAAGG - Intergenic
947368255 2:229418467-229418489 TGAAAATGTCAGTGGATAAATGG - Intronic
947868951 2:233421733-233421755 TGACAAGCCCTATGGAAAAACGG - Intronic
1169866493 20:10205640-10205662 TAAAAATCTCTAGGCATCAAAGG - Intergenic
1170013548 20:11755236-11755258 TCAAAATCTCCAGGGATAGACGG + Intergenic
1170498353 20:16948776-16948798 AGAAAATCTCCATGGAGAAGGGG - Intergenic
1171253029 20:23664103-23664125 TGAGAATGTCTAGGGACAAAAGG - Intergenic
1171259515 20:23719417-23719439 TGAGAATGTCTAAGGACAAAAGG - Intergenic
1171268586 20:23794884-23794906 TGAGAATGTCTAAGGACAAAAGG - Intergenic
1171325223 20:24285188-24285210 AGAAAATATCTCTGGATAGAAGG - Intergenic
1173162900 20:40665450-40665472 AGCAAATCTTTCTGGATAAATGG + Intergenic
1173425688 20:42941471-42941493 TGAATATCTGTATTGAAAAAGGG - Intronic
1175667977 20:60876620-60876642 TGAAAATCTCATTGGAAAACTGG + Intergenic
1176916630 21:14633622-14633644 GGAAAATCTTCATGGACAAATGG + Intronic
1177417591 21:20814522-20814544 TGAAAGTCTCTAGGGTGAAAAGG + Intergenic
1177451798 21:21278205-21278227 TGAGAATGTTTATGGATAGAAGG - Intronic
1177713205 21:24806656-24806678 TTAAAATCTCTATGGTGACATGG + Intergenic
1178027473 21:28484662-28484684 TTAAAATGTCTATCAATAAAAGG - Intergenic
1179273904 21:39873482-39873504 TGAAAATTTATATGCAAAAAGGG + Intronic
1184300900 22:43560196-43560218 TAAAAATCTCAATGGATATTTGG + Intronic
949089988 3:15947-15969 ATAAAATCTCCAGGGATAAATGG - Intergenic
949103426 3:174263-174285 GGAAAAGCTGGATGGATAAATGG - Intergenic
951392454 3:22123329-22123351 TTAAAATCTTTATGGGTACATGG + Intronic
951606929 3:24445513-24445535 TTAACATCTCAATGGATAAATGG + Intronic
951635933 3:24777189-24777211 TGATTATCTCAATAGATAAACGG - Intergenic
951685425 3:25338584-25338606 TGAACTTCCCTATGGTTAAAAGG - Intronic
952653095 3:35749650-35749672 TGAAAATCTCTAGGGTCAAATGG - Intronic
952871127 3:37902378-37902400 TGAAGATCTCTAAGGACATAGGG + Intronic
953588215 3:44224571-44224593 TCAAAATCACTTTAGATAAAGGG - Intergenic
953761859 3:45694665-45694687 TGAAAATCTCTGGGGATGAGCGG + Intronic
955738653 3:62066411-62066433 GGAAAATCATTTTGGATAAATGG - Intronic
956306012 3:67826405-67826427 TAAACATCTCAATGGAAAAATGG - Intergenic
956804017 3:72789862-72789884 GGAAAATCTCTCTGAAGAAAGGG + Intronic
956919881 3:73916274-73916296 CAAAAATCTATGTGGATAAAAGG - Intergenic
957029656 3:75225647-75225669 ATAAAATCTCAAGGGATAAATGG - Intergenic
957302260 3:78407581-78407603 TGAATACCTTTAAGGATAAAAGG - Intergenic
957525376 3:81372680-81372702 TAAAAATCTATATAGATACATGG - Intergenic
957993453 3:87656395-87656417 TTAAAATCTCTCTGTAGAAATGG + Intergenic
958041515 3:88231582-88231604 GGAAAATCTCTATGGTTTTAAGG - Intergenic
958136448 3:89500417-89500439 TAGGAATCTCTATGCATAAAAGG + Intergenic
958557032 3:95692562-95692584 ATAAAATCTCTAAGGATAGAAGG - Intergenic
958897630 3:99846762-99846784 TGAAGATCTTTAAGAATAAAAGG - Intronic
959484742 3:106913685-106913707 TGGAAATTAGTATGGATAAAAGG - Intergenic
959902768 3:111678432-111678454 TGATATTCTCTATGGACAAATGG + Intronic
962004133 3:131331309-131331331 TAAAAATATCTACTGATAAATGG - Intronic
963372186 3:144414735-144414757 TCAAAATCTCTACAGACAAAAGG - Intergenic
964080355 3:152746837-152746859 TGAAAATATCTAGGCATAAAAGG - Intergenic
964086191 3:152821472-152821494 TTCAAATCTCCATGGATAATAGG + Intergenic
964813420 3:160690764-160690786 TGAATATCACTATGGATTTATGG - Intergenic
966081552 3:176010020-176010042 TAAAAATGTGTATGTATAAATGG - Intergenic
966528024 3:180941988-180942010 GGAAAATTTCTTTGGAAAAATGG + Intronic
967333583 3:188317850-188317872 TGAAAGTCTCAATGGAGAAGAGG + Intronic
967525242 3:190485379-190485401 TGAAAAACACTTTTGATAAAGGG - Intergenic
967801950 3:193671739-193671761 TGAAATTGTTTATGCATAAAAGG + Intronic
968532670 4:1102437-1102459 GAAAAATCTCTATGTATACATGG + Intronic
970274411 4:14382500-14382522 AGAAGATTTCTTTGGATAAAGGG + Intergenic
970899712 4:21144625-21144647 TGGAAAGCTCTATGGAACAACGG - Intronic
971044927 4:22795028-22795050 TGCAAATCTCTTTGACTAAACGG - Intergenic
971866551 4:32179540-32179562 TGGAAAGTTCTATTGATAAAAGG - Intergenic
972389077 4:38595894-38595916 TTTAAACCTCTATGAATAAAAGG + Intergenic
973084928 4:46046624-46046646 TGAAAATCTCTTTGCTGAAAAGG + Intronic
973557011 4:52093468-52093490 TGAAAATCTCTAAGAGCAAAAGG - Intronic
974186195 4:58450482-58450504 ACAAATTCTCTATGGGTAAAAGG + Intergenic
974418300 4:61639549-61639571 TTAAAATCTCTCTGGAAAATAGG + Intronic
974676606 4:65098122-65098144 TTAAAATTTTTATGGAGAAAGGG + Intergenic
974679627 4:65144765-65144787 TCAAAATGTTTATGGAAAAATGG - Intergenic
975480091 4:74868565-74868587 TGTAAGTCTCTCTGGAGAAAAGG + Intergenic
977245875 4:94630673-94630695 TGAAAATATCAATGGATACTAGG - Intronic
977794453 4:101145993-101146015 TGAAAATATCTGTGAATCAATGG - Intronic
978292617 4:107162619-107162641 TGAGAATTTCTATGTATATATGG - Intronic
978473512 4:109098015-109098037 TGACATTCTCTAGGGATAGATGG + Intronic
978979095 4:114919533-114919555 TGAAAACCTATATGGAAAGAAGG + Intronic
979462058 4:120995046-120995068 TTAAAATCTATATTCATAAATGG - Intergenic
979793298 4:124813391-124813413 TAAATATCTATATTGATAAATGG - Intergenic
980907359 4:138961457-138961479 TGAGAGTCTCTATGGGGAAATGG - Intergenic
980946012 4:139321277-139321299 AGAAAATCTCAATGAAGAAATGG - Intronic
980986399 4:139699632-139699654 TGAAAATATCCATGCATAAATGG + Intronic
981457634 4:144972874-144972896 TGAAAATCTCTATATATTTAAGG + Intronic
981540238 4:145838641-145838663 TGAGAATGTCCATGGAAAAATGG + Intronic
982211338 4:153039131-153039153 TGACACTCTCTGTGGACAAATGG - Intergenic
982886981 4:160793982-160794004 TTTAAATCCCTATGTATAAATGG - Intergenic
984452618 4:179923121-179923143 TGATAATCTCCATTTATAAAAGG - Intergenic
984660649 4:182371134-182371156 TGAAAATGACTAGGGCTAAAAGG - Intronic
985154830 4:186975991-186976013 TGAAAATCTATATGCATTTATGG - Intergenic
986380287 5:7178058-7178080 TGAAAGTCTTTATGGAAAAGAGG + Intergenic
986615459 5:9613012-9613034 TGAAAATCACTATAAATATATGG + Intergenic
987717963 5:21595711-21595733 TTAAAATCTCAATGGAGTAATGG - Intergenic
987839356 5:23203000-23203022 TGAAAAACCCTATTGAAAAATGG + Intergenic
987939634 5:24516453-24516475 TGAAAATCACTATTAGTAAATGG - Intronic
988803585 5:34719384-34719406 TGACAATCTCAATGGATGGAAGG - Intronic
992585071 5:78230215-78230237 TGACAATTTCTGTAGATAAATGG - Intronic
993719350 5:91306944-91306966 TGAAACTATCTATGACTAAAAGG - Intergenic
995159727 5:108965346-108965368 TGAAAATCTCTGTAGTTATATGG + Intronic
997015507 5:129929785-129929807 TGAAAATCTCTATGGATAAATGG + Intronic
997166799 5:131669166-131669188 AGAAAATCTAAATGTATAAAAGG + Intronic
998366162 5:141633446-141633468 ATAAAATATTTATGGATAAAAGG + Intronic
999540071 5:152561558-152561580 TGGATACCTCTATGGATAGACGG - Intergenic
1000360851 5:160445960-160445982 TGAAAATGTATAGGGGTAAAAGG + Intergenic
1000427150 5:161104844-161104866 TCAAAAGATCTATAGATAAATGG + Intergenic
1001326286 5:170728107-170728129 TGAAAATTATTATGAATAAATGG - Intronic
1004778722 6:18880816-18880838 GTAGAATCTCAATGGATAAATGG - Intergenic
1006555921 6:34866509-34866531 TGAAAATATTTATGGACAAAAGG - Intronic
1008717737 6:54309538-54309560 TGAAAAAGTCTAAGGTTAAATGG + Intronic
1008961235 6:57268433-57268455 TCAAAATGTCTATGCATAAAAGG + Intergenic
1010495268 6:76527132-76527154 TTAAAATTTGTATGGAGAAAAGG - Intergenic
1011240075 6:85262386-85262408 TGAATAACTCTATGGATCAAAGG + Intergenic
1011268169 6:85547810-85547832 TCAAAATCTCACTGGATCAAAGG + Intronic
1011622356 6:89255127-89255149 GGAGAGTCTCTATAGATAAAAGG + Intergenic
1011905834 6:92366298-92366320 AGAACATCTCTAAGGACAAAGGG - Intergenic
1012952226 6:105530370-105530392 TGACAATCTGTATGGACAATAGG + Intergenic
1014039283 6:116806243-116806265 TGAAAGTGTCTATTTATAAAAGG + Intronic
1014381388 6:120747267-120747289 TCAGAATCTCTAGGGATGAAAGG + Intergenic
1014402142 6:121003511-121003533 TTAAAATTTTTATGGATACATGG - Intergenic
1014467131 6:121770363-121770385 TTAAAAACTCTATGTATAAAAGG + Intergenic
1015359604 6:132323586-132323608 GAAAAATCAATATGGATAAAAGG + Intronic
1016115135 6:140271963-140271985 TGGTAATCTCTATTTATAAATGG + Intergenic
1016304944 6:142674126-142674148 TGAAAATTTGAATAGATAAATGG - Intergenic
1017062316 6:150495397-150495419 TGACACTGTCTATGGATAAATGG + Intergenic
1017406456 6:154124880-154124902 AGATAATTTCTTTGGATAAAAGG - Intronic
1017460238 6:154642629-154642651 TGAGTATCTATATGGAAAAAAGG - Intergenic
1018467544 6:164064214-164064236 TGAAAATCACCATGTATACATGG - Intergenic
1019698906 7:2463139-2463161 TGAAAAGTTTTGTGGATAAAGGG + Intergenic
1020549098 7:9575560-9575582 AGAAAATCTCTATTTATAAAGGG - Intergenic
1020934342 7:14442148-14442170 TGAAAATATCAATGAATGAAGGG + Intronic
1021061755 7:16121056-16121078 ACAAAATCACTAGGGATAAAAGG + Intronic
1021088776 7:16455898-16455920 TTAACATCTCAATGAATAAAAGG + Intergenic
1021195665 7:17671788-17671810 TGAAAAGATCTATGTAAAAATGG - Intergenic
1021219706 7:17961974-17961996 TGAATATCCCTATGAATATAAGG - Intergenic
1021851435 7:24812594-24812616 TAAAAATCTCTATGAAAGAATGG + Intronic
1022061084 7:26795919-26795941 TGAAAAAATCCATGGATAAGTGG - Intronic
1023520129 7:41041651-41041673 TTAAAATTTCTATGCATCAAAGG + Intergenic
1024142501 7:46476342-46476364 TGACTATCTCTCTGGATAAAAGG + Intergenic
1027351773 7:77319068-77319090 TAAAAATATATATGTATAAAAGG + Intronic
1027490269 7:78815115-78815137 CCAAAATATCTATGGCTAAATGG + Intronic
1027563632 7:79763561-79763583 TGAAACTCTGTAAGGAGAAATGG + Intergenic
1028476503 7:91259263-91259285 TGAAAATCTCTTTTGATAAGTGG + Intergenic
1028679960 7:93515912-93515934 TGTAAAAATCTATGTATAAATGG + Intronic
1030134174 7:106230695-106230717 AGATAAACTCTAAGGATAAAAGG + Intergenic
1030735326 7:113041439-113041461 TGAAAGTCTTTGTGGATGAATGG + Intergenic
1031267837 7:119604629-119604651 TGAAACTCACTAGGGACAAAAGG - Intergenic
1032404501 7:131646109-131646131 TGAAAAGTTCTGGGGATAAATGG - Intergenic
1032555296 7:132826830-132826852 TGAAAATTACTTTTGATAAAGGG - Intronic
1034290240 7:149924949-149924971 TGAAAATCCCTAGGGATCAAGGG + Intergenic
1034660831 7:152767895-152767917 TGAAAATCCCTAGGGATCAAGGG - Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1037069246 8:14622947-14622969 TGAAAATATCAATAGATACATGG - Intronic
1037227999 8:16619072-16619094 TGAAAATAACTATGGTTAATAGG - Intergenic
1037548058 8:19942567-19942589 AGAAAGTCTCTGTTGATAAAAGG - Intronic
1039258383 8:35743820-35743842 TGGAAGTATCTAGGGATAAAGGG - Intronic
1039327720 8:36503392-36503414 TCAAAGTCTCTATGGAAAGATGG + Intergenic
1043128618 8:76432720-76432742 TGGAAACCTCTATGGATGGAAGG - Intergenic
1043143303 8:76618393-76618415 TGAATATCTCTGTGGGTATAAGG + Intergenic
1043377221 8:79664167-79664189 TAAAAATCTTTATGGAGAAAAGG + Intronic
1043793689 8:84507715-84507737 TGCAAACCTCTGTGGATACAAGG - Intronic
1044158011 8:88874538-88874560 TGCAAATATTTATGGATACATGG - Intergenic
1044336835 8:90994817-90994839 TAAATATATCTTTGGATAAATGG + Exonic
1045160174 8:99532317-99532339 TGAAATTATCTATGGAGAAAAGG - Intronic
1046163557 8:110398410-110398432 AGAAAATCTAAATGAATAAAGGG - Intergenic
1046494150 8:114992616-114992638 TGATAATTTCTATGGGTAATAGG + Intergenic
1046738902 8:117807989-117808011 TGAAAATCACTAAGAATAAGTGG + Intronic
1047567397 8:126060854-126060876 TGAATATCTATCTGGATAACTGG - Intergenic
1047819012 8:128497744-128497766 TGAAAATCTTTATTAAAAAATGG + Intergenic
1048639733 8:136341446-136341468 TGAAAATCTCTCAGTATACAAGG + Intergenic
1050964431 9:11780433-11780455 TGGAAATCGCTAGAGATAAAAGG - Intergenic
1050998459 9:12249480-12249502 TGAGAAGATCTATGCATAAAAGG + Intergenic
1051679428 9:19592372-19592394 TGGAAATGTCTTTGGTTAAATGG + Intronic
1055415362 9:76076535-76076557 TGAAAATCTCTCTTGATACTTGG - Intronic
1055695890 9:78883976-78883998 AGAAAAGCTCTATAGATAAGTGG - Intergenic
1055971632 9:81917872-81917894 TGAAGATTTCTATGGATTCAAGG - Intergenic
1055980170 9:81993236-81993258 TGAAGATTTCTATGGATTCAAGG - Exonic
1056263188 9:84869382-84869404 TGAAAATCTCGTTTGATATATGG - Intronic
1056480489 9:86998797-86998819 TGAAAAACTCAATGGAAGAATGG + Intergenic
1056492141 9:87118657-87118679 AGAAAATCTATATTTATAAAAGG - Intergenic
1057962464 9:99469826-99469848 TGAAAAACTCTGTGGCTACAAGG - Intergenic
1058268279 9:102934990-102935012 TGAAAACCACTATCCATAAAAGG - Intergenic
1059045963 9:110867070-110867092 TGAAAATCACTATGCCAAAAGGG - Intergenic
1059413246 9:114147285-114147307 TGAAAAGCTCTTTGCAGAAATGG + Intergenic
1059541461 9:115134584-115134606 TGAAAATCTCTATTCCTAAGTGG - Intergenic
1061472317 9:130836061-130836083 TGAAATTCTGTATCCATAAATGG - Intronic
1187641878 X:21300229-21300251 TGCAATTTTCTTTGGATAAATGG + Intergenic
1188146079 X:26615640-26615662 TTAAATTCTCTATGTACAAATGG - Intergenic
1188392827 X:29642023-29642045 TGAAAATCACTATAAAGAAAAGG + Intronic
1189662501 X:43316949-43316971 TGAAAAACTGTATTCATAAAAGG + Intergenic
1189746413 X:44173148-44173170 TGAAAAACAATATGGCTAAAGGG - Intronic
1191756187 X:64594915-64594937 TGAATATCTCCATCTATAAAGGG + Intergenic
1191855798 X:65625508-65625530 TGAAATTATATATTGATAAAAGG - Intronic
1194388217 X:93283225-93283247 TCTAAAACTCTTTGGATAAAAGG - Intergenic
1197089138 X:122515935-122515957 TGAACATCTCTATGCACACAAGG + Intergenic
1197339225 X:125245146-125245168 TGAAAATGACAACGGATAAAGGG + Intergenic
1197925282 X:131640119-131640141 TAAAAATCTAAGTGGATAAATGG + Intergenic
1198334935 X:135656819-135656841 TGAGAATTGCTATGGATAAAAGG - Intergenic
1199220775 X:145313635-145313657 TCAACATATTTATGGATAAACGG - Intergenic
1199819434 X:151430279-151430301 TTAAAATCTTTATGCAAAAATGG + Intergenic
1200330448 X:155291274-155291296 TGAAAATATCTATTGAAAATGGG - Intronic
1200341734 X:155404171-155404193 TGAAAACATCTATGTATAAGTGG + Intergenic
1200384107 X:155871709-155871731 TGAAAATTTCTATGGTATAAGGG + Intergenic
1201981322 Y:19913203-19913225 TGTTAATCTTTATGGATACATGG - Intergenic