ID: 997022151

View in Genome Browser
Species Human (GRCh38)
Location 5:130014345-130014367
Sequence TATGAAGAAATACCCAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4943
Summary {0: 1, 1: 36, 2: 515, 3: 1172, 4: 3219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997022149_997022151 10 Left 997022149 5:130014312-130014334 CCAATTTACTGTATTAGTCCATT 0: 554
1: 1022
2: 1680
3: 1722
4: 1460
Right 997022151 5:130014345-130014367 TATGAAGAAATACCCAAAAGTGG 0: 1
1: 36
2: 515
3: 1172
4: 3219
997022150_997022151 -8 Left 997022150 5:130014330-130014352 CCATTTTCATGCTGCTATGAAGA 0: 38
1: 668
2: 1158
3: 2367
4: 3574
Right 997022151 5:130014345-130014367 TATGAAGAAATACCCAAAAGTGG 0: 1
1: 36
2: 515
3: 1172
4: 3219
997022148_997022151 17 Left 997022148 5:130014305-130014327 CCTGGTACCAATTTACTGTATTA 0: 233
1: 521
2: 568
3: 438
4: 322
Right 997022151 5:130014345-130014367 TATGAAGAAATACCCAAAAGTGG 0: 1
1: 36
2: 515
3: 1172
4: 3219
997022147_997022151 22 Left 997022147 5:130014300-130014322 CCACTCCTGGTACCAATTTACTG 0: 133
1: 283
2: 345
3: 392
4: 411
Right 997022151 5:130014345-130014367 TATGAAGAAATACCCAAAAGTGG 0: 1
1: 36
2: 515
3: 1172
4: 3219
997022146_997022151 23 Left 997022146 5:130014299-130014321 CCCACTCCTGGTACCAATTTACT 0: 163
1: 305
2: 414
3: 457
4: 541
Right 997022151 5:130014345-130014367 TATGAAGAAATACCCAAAAGTGG 0: 1
1: 36
2: 515
3: 1172
4: 3219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997022151 Original CRISPR TATGAAGAAATACCCAAAAG TGG Intronic
Too many off-targets to display for this crispr