ID: 997023124

View in Genome Browser
Species Human (GRCh38)
Location 5:130025656-130025678
Sequence CTGTCTATGACTCAAAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997023124_997023131 18 Left 997023124 5:130025656-130025678 CCTGGTTTTTGAGTCATAGACAG 0: 1
1: 0
2: 4
3: 9
4: 165
Right 997023131 5:130025697-130025719 CTCCCATAGCAGAAGGGCCAGGG No data
997023124_997023130 17 Left 997023124 5:130025656-130025678 CCTGGTTTTTGAGTCATAGACAG 0: 1
1: 0
2: 4
3: 9
4: 165
Right 997023130 5:130025696-130025718 CCTCCCATAGCAGAAGGGCCAGG 0: 1
1: 0
2: 2
3: 38
4: 306
997023124_997023134 28 Left 997023124 5:130025656-130025678 CCTGGTTTTTGAGTCATAGACAG 0: 1
1: 0
2: 4
3: 9
4: 165
Right 997023134 5:130025707-130025729 AGAAGGGCCAGGGAACTCCCTGG 0: 1
1: 1
2: 2
3: 36
4: 366
997023124_997023128 12 Left 997023124 5:130025656-130025678 CCTGGTTTTTGAGTCATAGACAG 0: 1
1: 0
2: 4
3: 9
4: 165
Right 997023128 5:130025691-130025713 TGTGTCCTCCCATAGCAGAAGGG No data
997023124_997023135 29 Left 997023124 5:130025656-130025678 CCTGGTTTTTGAGTCATAGACAG 0: 1
1: 0
2: 4
3: 9
4: 165
Right 997023135 5:130025708-130025730 GAAGGGCCAGGGAACTCCCTGGG No data
997023124_997023127 11 Left 997023124 5:130025656-130025678 CCTGGTTTTTGAGTCATAGACAG 0: 1
1: 0
2: 4
3: 9
4: 165
Right 997023127 5:130025690-130025712 CTGTGTCCTCCCATAGCAGAAGG 0: 1
1: 33
2: 352
3: 893
4: 2079

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997023124 Original CRISPR CTGTCTATGACTCAAAAACC AGG (reversed) Intronic
901780721 1:11592988-11593010 CTTTCTATCATTCAAAGACCAGG + Intergenic
902354530 1:15887686-15887708 CTTGCTATGTCTCAAACACCAGG - Intronic
905110757 1:35592770-35592792 CTGTCTATGAGCCAGAAAGCAGG - Intronic
908262028 1:62346477-62346499 CCGTCTATGAGCCAAAAAGCAGG + Intergenic
908338480 1:63151684-63151706 ATATCTATGACTCAAAATTCTGG + Intergenic
908631486 1:66114167-66114189 CTGTCTATGAACCAGAAAGCAGG + Intronic
914394909 1:147256298-147256320 CTGTCTTAGACTGAAAAACAAGG - Intronic
916782755 1:168053668-168053690 CTGCTTATAACTCAAAATCCAGG + Intronic
919669202 1:200323637-200323659 ATGTCCATTACTCAAAAGCCAGG + Intergenic
920077596 1:203348506-203348528 CTGTCTGTGACTCTATGACCAGG - Intronic
922705009 1:227786068-227786090 CTGTCTCTGAATCAATAACGTGG + Intergenic
1062870483 10:898681-898703 TTGTCTCTGAATCAGAAACCTGG + Intronic
1063217751 10:3939247-3939269 CTGTCTATGATGCAGAAAGCAGG + Intergenic
1063559127 10:7110181-7110203 CTGTTTATGAACCAGAAACCAGG - Intergenic
1065314592 10:24450834-24450856 CTGTCCAGGACTTAAAAACAAGG - Intronic
1068295232 10:55062280-55062302 CTCTCTATGAATCAGAAAGCTGG + Intronic
1072253995 10:93602867-93602889 CTCTCTATCACTAAAGAACCTGG - Intronic
1074394710 10:113088242-113088264 CTGTCTATGGCTCTATAAACAGG - Intronic
1075130385 10:119732997-119733019 CAGTGTTTGACTCTAAAACCAGG + Intronic
1076480478 10:130782068-130782090 CTGTCTATGACACAACATCTAGG - Intergenic
1077045075 11:541097-541119 CTGTCTGTGACCCAAATGCCTGG - Intronic
1079253151 11:18802499-18802521 TTCTCTATGACTCTAAATCCAGG + Intergenic
1082182351 11:49134804-49134826 TTATCAATGACTCAAACACCTGG - Intergenic
1085492810 11:76936492-76936514 CTTTCTATGATTCAAAATTCAGG + Intronic
1086236793 11:84641070-84641092 CTGTGTGTGACTCTAACACCTGG - Intronic
1087313514 11:96578105-96578127 CTTCCTAAGACTCAAAAATCAGG - Intergenic
1087704053 11:101468651-101468673 CTGACTATGACAAAAAATCCAGG + Intronic
1089229765 11:116963063-116963085 CTGTCTATCTCACAGAAACCTGG + Intronic
1090155801 11:124437546-124437568 CTGTCTATGAGGCAGAAAGCGGG - Intergenic
1093021609 12:14209142-14209164 CTATCTATGAGCCAAAAAGCAGG - Intergenic
1095467551 12:42503883-42503905 CTGCCTATAATTCAAAAAGCGGG + Intronic
1098228977 12:68353612-68353634 CTGTCTTTGATTCCACAACCAGG - Intergenic
1099205981 12:79727257-79727279 CTTTCTCTAACTAAAAAACCAGG + Intergenic
1099790945 12:87332684-87332706 CTGTCTATGAGCCAGAAAGCAGG + Intergenic
1101426465 12:104592391-104592413 CTGTCTATGAACCAGAAAGCAGG - Intronic
1101534370 12:105604012-105604034 CAGTCTATGACTCCACAACAAGG - Intergenic
1102377730 12:112437044-112437066 CTTTCTATGACTCAAAATCCAGG - Intronic
1106937023 13:34734376-34734398 CTGTCTATGACTCTATAACCAGG + Intergenic
1111601966 13:90485765-90485787 CTGTCTTTGACACAAAAGCCTGG - Intergenic
1113819217 13:113200197-113200219 CTGTCTAGGAATCAAACACAAGG + Intronic
1124713442 15:32033650-32033672 CTGGCTCTGCTTCAAAAACCAGG - Intronic
1125034152 15:35104466-35104488 GTGTCTTTGACTTAAAAAGCAGG - Intergenic
1129830243 15:78664516-78664538 CTGTTTTTGTCTCTAAAACCTGG + Intronic
1131901914 15:97097064-97097086 CTGTCATTGATTCTAAAACCAGG - Intergenic
1133273590 16:4623933-4623955 CTGTGTGTGACTCAAAAGCCAGG + Intronic
1140032197 16:71347818-71347840 CTGTGTGTGACTCTAAAGCCAGG + Intergenic
1140636257 16:76918151-76918173 CTTTCCATGACTCAATAACCCGG - Intergenic
1148534113 17:48424142-48424164 CTATCTATGAACCAAAAAGCAGG - Intronic
1149207990 17:54270664-54270686 CTCTGTCTGACTCAAAATCCTGG + Intergenic
1153580331 18:6566806-6566828 GTGGCTATGACTCAACAACTGGG - Intronic
1155704745 18:28794665-28794687 GTTTCTATGACTCAGAATCCTGG - Intergenic
1155774396 18:29740458-29740480 CTGTCTCTGTCTCCAACACCTGG - Intergenic
1156575603 18:38311956-38311978 CTGTCTATGAACCAGAAAACAGG - Intergenic
1156874821 18:41996911-41996933 TTGTCTATGAGTCAACAAACAGG - Intronic
1156881789 18:42088720-42088742 CTTTCCATTTCTCAAAAACCTGG - Intergenic
1158005074 18:52662827-52662849 CTGTCTATGAACCAGAAAGCAGG - Intronic
1158873552 18:61711457-61711479 CTCTATATGACTGAAAAACAGGG + Intergenic
1159391958 18:67805052-67805074 CTGTTTCTGATTCAAAAACTAGG - Intergenic
1161129775 19:2581069-2581091 CAGTCTCTGCCTCAACAACCAGG - Intronic
1161359819 19:3841608-3841630 CTGGCTATGTCTCAAATTCCTGG - Intronic
1162607046 19:11717261-11717283 CTGTCTGTGAATCAGAAAACAGG - Intergenic
1167334322 19:48875237-48875259 CTTTCTAAGACTCAAGAATCTGG - Intronic
926344533 2:11933204-11933226 CTGTCTATGAGCCAGAAAGCAGG - Intergenic
927082009 2:19639770-19639792 TTGTCTGTGACTCAAAATCATGG - Intergenic
927258670 2:21063688-21063710 CTCTCCATCACTCAAAAACGTGG + Intergenic
927318796 2:21718585-21718607 GTGCCTATGACTGAAAAATCAGG - Intergenic
928039902 2:27864685-27864707 CTGTCTCTGATTCAAAAACCTGG - Intronic
928200079 2:29242216-29242238 CTGACCAGGACTCAGAAACCTGG - Intronic
929325278 2:40602772-40602794 CAGTCTATGAATCAGAAAGCAGG + Intronic
932784987 2:74592690-74592712 CTAACTATGACTCAAAATCCAGG - Intronic
933623094 2:84567058-84567080 CTAACTATGACTTAAAAATCTGG + Intronic
936450952 2:112633738-112633760 CTGTCTATGAACCAGAAAGCAGG + Intergenic
937401983 2:121592129-121592151 CTGTCTATAGCTGAATAACCTGG + Intronic
939112232 2:138021961-138021983 CTGTCTAAGAGTTAAACACCTGG - Intergenic
940619006 2:156087229-156087251 CTGTCTATGAACCAGAAAACAGG - Intergenic
944461191 2:199952690-199952712 CTAGCTATGACTCAAAATTCAGG - Intronic
945682623 2:212932428-212932450 ATGTTTCTTACTCAAAAACCTGG + Intergenic
946610113 2:221448835-221448857 TTGTCAATGAAACAAAAACCTGG + Intronic
948051272 2:234981221-234981243 CAGTCCATGACCCAAAGACCAGG - Intronic
1173446947 20:43127695-43127717 ATGTCCATGACTCACCAACCTGG - Intronic
1174487405 20:50870218-50870240 CTGACCCTGACCCAAAAACCAGG + Intronic
1174696529 20:52565236-52565258 CTGTCTATGAGCCAAAAAGTGGG - Intergenic
1175544078 20:59766869-59766891 GTGTGTCTGACTCCAAAACCTGG + Intronic
1180064741 21:45406496-45406518 TTGTCTACGACTCAACAAGCAGG - Intronic
1181385880 22:22545356-22545378 CTGTCTAAAAATCAAAAGCCAGG - Intergenic
1181574025 22:23782700-23782722 CTGGCTGTGGCTGAAAAACCAGG - Intronic
1181906804 22:26204193-26204215 CTTTCTATGACTCTAGTACCTGG - Intronic
1182190078 22:28450736-28450758 CTGTCTACGACACAACAACTGGG + Intronic
951577829 3:24131730-24131752 CTGTCTATGAATCAGGAAGCAGG + Intronic
951627539 3:24682422-24682444 TGGTCTATGGCTCAAAAACAAGG + Intergenic
953580866 3:44155066-44155088 CTGAATATGACTTTAAAACCTGG - Intergenic
955959666 3:64327379-64327401 CTTTCTATCCCTTAAAAACCTGG - Intronic
955963206 3:64362173-64362195 ATGGCTTTGACTCAAAATCCAGG - Intronic
956566341 3:70642966-70642988 CAGTCAATGACTCAAGGACCCGG + Intergenic
957448657 3:80347005-80347027 CTTTATATGATTCTAAAACCAGG + Intergenic
957450733 3:80378605-80378627 CTGTCTATGAATCAGAAAGAAGG - Intergenic
957868412 3:86055362-86055384 CTATCTATGAACCAAAAAGCAGG - Intronic
960083209 3:113563428-113563450 TTGACTATGACTCAAAATTCAGG + Intronic
960166072 3:114402844-114402866 TTCTCTTTGCCTCAAAAACCAGG + Intronic
960398870 3:117171222-117171244 CTGTCTTTGACTCAAAAACAAGG - Intergenic
962027691 3:131566109-131566131 ATGTCTATGACCAAAACACCAGG + Intronic
962303648 3:134266767-134266789 CTATTTGTAACTCAAAAACCGGG + Intergenic
962373719 3:134842193-134842215 CTGTCTATGAATCAGAAAGTGGG + Intronic
963059703 3:141215306-141215328 CTGTCTATGAACCAGAAAGCAGG - Intergenic
964379565 3:156084457-156084479 CTGTTTCTGACTCCTAAACCTGG + Intronic
968336765 3:197920249-197920271 CTGTCTATGACTTAGAATACCGG + Intronic
970076661 4:12229635-12229657 CTGTCTATGAATAAGAAAGCAGG + Intergenic
971930077 4:33070008-33070030 CTTTCTATGAGTCAAGAATCTGG - Intergenic
973537140 4:51894961-51894983 CCATCTATGAATCAAAAAGCAGG - Intronic
974542553 4:63256837-63256859 CTATCTATGAATCAGAAAGCAGG + Intergenic
974822914 4:67090730-67090752 CTGTCTATGACTTAAAAATTTGG + Intergenic
974869106 4:67616885-67616907 CTGTTGATGACTGAAATACCAGG - Exonic
975470982 4:74767656-74767678 CTGTAGATGATTTAAAAACCAGG - Intronic
979138606 4:117144514-117144536 CTGTCTATGAATCAGAAAGCAGG + Intergenic
979319129 4:119301878-119301900 CTATCTTTGTCTCTAAAACCTGG - Intronic
979585019 4:122405126-122405148 CTGAATCTGACTCAATAACCAGG - Intronic
984088836 4:175345068-175345090 CTGACTATGACTGAAGAACAGGG - Intergenic
985116596 4:186598159-186598181 CACTCAATGACTCAGAAACCTGG + Intronic
985150546 4:186942921-186942943 CTGTCTATGATGCAAGAAGCAGG + Intergenic
986727779 5:10612302-10612324 CTGTCTATGAAACAGAAAGCAGG - Intronic
988978197 5:36536378-36536400 CTGTCCATGACTCTCAAATCAGG - Intergenic
992101792 5:73415249-73415271 CTCTCTATACCTCAAAAACCTGG - Intergenic
992893438 5:81225927-81225949 CTGTCTTTGACCCAAACAGCTGG - Exonic
992965344 5:81993730-81993752 CTTTCTATGTGTCAGAAACCAGG - Intronic
997023124 5:130025656-130025678 CTGTCTATGACTCAAAAACCAGG - Intronic
997559961 5:134837683-134837705 CTGTCTGTGAATCAGAAAGCTGG + Intronic
1000413270 5:160956393-160956415 CTGTGTATGACTAAAAAATTCGG - Intergenic
1000455761 5:161446862-161446884 GTCTCTGTGACTCAAAAACTTGG - Intronic
1005449498 6:25959124-25959146 CTGGCTGTGAGACAAAAACCCGG + Intergenic
1007277105 6:40682503-40682525 ATGTCTATGGCTCTTAAACCTGG + Intergenic
1008577553 6:52875591-52875613 CTGTCTATGAATCAAGGAACAGG + Intronic
1010789197 6:80045234-80045256 CTTTCTATCACTGAAAAGCCAGG + Intergenic
1011719060 6:90136328-90136350 ATCTCTCTGACTCCAAAACCAGG - Intronic
1016745109 6:147571034-147571056 ATGACTATGTCTTAAAAACCAGG - Intronic
1017312770 6:152993201-152993223 CTTTCTAGTCCTCAAAAACCTGG + Intronic
1018144150 6:160867051-160867073 CTTTCTATGTCTCATAACCCGGG - Intergenic
1021254748 7:18377157-18377179 CTGTCTATGAATCAGGAAGCAGG - Intronic
1021647673 7:22802309-22802331 CTGGTTGTGACACAAAAACCTGG + Intergenic
1021724503 7:23536000-23536022 CTAACTATGACTTAAAATCCAGG - Intergenic
1021808956 7:24384049-24384071 CTGTCTATGAATCAGGAAGCAGG + Intergenic
1022512251 7:30946270-30946292 CTGTCTATGAACCAAAAAGAGGG + Intronic
1023540798 7:41263760-41263782 TTTTCTCTGTCTCAAAAACCAGG - Intergenic
1023921649 7:44634725-44634747 CTGCCTATGAAGCAAAAACAAGG - Intronic
1025241210 7:57277654-57277676 CTGTCTATGCCTCAGAAAAGTGG - Intergenic
1027167021 7:75842092-75842114 TTGTCTGTGCCTCAAAATCCAGG + Intergenic
1030672560 7:112353207-112353229 CTGCCCATGAATCAAAAGCCAGG + Intergenic
1030755117 7:113278397-113278419 CTATGTATGACTCACAACCCTGG - Intergenic
1031637856 7:124123079-124123101 CTGTTTATGAATCAAAAAGGAGG - Intergenic
1035077062 7:156186903-156186925 CTGTCTATGAGCCAGAAAGCAGG + Intergenic
1036227634 8:6973158-6973180 CCGTCTATGAATCACAAAACTGG + Intergenic
1036230089 8:6992317-6992339 CCGTCTATGAATCACAAAACTGG + Intergenic
1036232541 8:7011420-7011442 CCGTCTATGAATCACAAAACTGG + Intronic
1038316658 8:26490145-26490167 CTGTCTATGAACCAGAAAGCAGG - Intronic
1038732753 8:30141880-30141902 GCATCTATGACTCAAAAGCCTGG + Intronic
1041938836 8:63364789-63364811 TTGTCTATTACTCCAAAAGCAGG + Intergenic
1043276015 8:78393881-78393903 CTTTCTGTGACTCAATAACCAGG + Intergenic
1044321581 8:90808190-90808212 CTGTCAAAGGCTCAAAAATCAGG + Intronic
1045041811 8:98231673-98231695 CTGTCATTGACTTAATAACCTGG + Intronic
1045702720 8:104885258-104885280 CTGTCTATAATTCACAAAGCAGG + Intronic
1046264048 8:111807755-111807777 CTGTCTATGAATCAGAAAGCAGG - Intergenic
1046465203 8:114592656-114592678 CTGCCTTTGACTCAGAAAACAGG - Intergenic
1048590765 8:135818601-135818623 CTGTTTCTCAGTCAAAAACCTGG - Intergenic
1051365607 9:16319461-16319483 CTGTCTATAAATCAGAAAGCAGG + Intergenic
1051474375 9:17487857-17487879 CTGGCTATGACTAGAAAAGCAGG - Intronic
1051614649 9:18995573-18995595 CTGTTTATGATTCCTAAACCTGG + Intronic
1052548401 9:29911596-29911618 GTGTCTGTGACTTAAAAACTAGG + Intergenic
1055649038 9:78389114-78389136 TTGTCTATGAACCAAAAAGCTGG + Intergenic
1056744194 9:89286080-89286102 CTTTCTTGGACTCAAAAACATGG - Intergenic
1058506664 9:105673588-105673610 CTAACTACGACTCAAAATCCAGG - Intergenic
1059771167 9:117427546-117427568 CCATCTGTGAATCAAAAACCTGG + Intergenic
1061883313 9:133578691-133578713 CTGTCTCAGACCCAACAACCTGG - Exonic
1185938519 X:4286041-4286063 CTGTCTATGAATCAGGAAGCGGG + Intergenic
1185967937 X:4628662-4628684 CTGTCTATGAACCAGAAAGCAGG + Intergenic
1186082782 X:5951653-5951675 CTGTCTATGACCCAGAAAGTGGG - Intronic
1186966642 X:14794137-14794159 CTGTCTTTGACTCTTCAACCTGG - Intergenic
1191599663 X:62989355-62989377 CTATCTATGACTAAACAACTTGG - Intergenic
1195987620 X:110647345-110647367 CTTTCTATGAATCAGAAAACAGG + Intergenic
1196155330 X:112422392-112422414 CTATCTATGACCCAGAAAACAGG + Intergenic
1198541356 X:137643566-137643588 CTCTCTATGAACCAAAAAGCAGG - Intergenic