ID: 997023131

View in Genome Browser
Species Human (GRCh38)
Location 5:130025697-130025719
Sequence CTCCCATAGCAGAAGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997023124_997023131 18 Left 997023124 5:130025656-130025678 CCTGGTTTTTGAGTCATAGACAG 0: 1
1: 0
2: 4
3: 9
4: 165
Right 997023131 5:130025697-130025719 CTCCCATAGCAGAAGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997023131 Original CRISPR CTCCCATAGCAGAAGGGCCA GGG Intronic
No off target data available for this crispr