ID: 997023511

View in Genome Browser
Species Human (GRCh38)
Location 5:130030154-130030176
Sequence AGGTGAGATAATTCAAATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 341}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997023511 Original CRISPR AGGTGAGATAATTCAAATTG TGG (reversed) Intronic
901460722 1:9389783-9389805 AGGTGGGACAATTCGAAGTGGGG - Intergenic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905057002 1:35104120-35104142 AGATGAGAAAATTAAAATTTAGG + Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
905823030 1:41008859-41008881 AGGAGAGAGAATGGAAATTGTGG + Exonic
907795873 1:57716464-57716486 AGGTGCGAAAATACACATTGGGG + Intronic
908171754 1:61511903-61511925 AGGTGAGATAACTTAAATCAAGG + Intergenic
908910174 1:69063967-69063989 AGGTGGGAAAACTCAAAGTGAGG + Intergenic
910983805 1:92984640-92984662 AAGTGAGAAAATTCACCTTGTGG - Intergenic
913676474 1:121145782-121145804 AGGTCAGGTAATGAAAATTGGGG - Intergenic
914028370 1:143933732-143933754 AGGTCAGGTAATGAAAATTGGGG - Intergenic
915880641 1:159667532-159667554 AGGTGGGACAACTCAAAGTGGGG + Intergenic
917312589 1:173692340-173692362 AGGTGGGACAACTCAAAGTGGGG + Intergenic
918720090 1:187841510-187841532 AGGTTGGACAATTCAAAGTGGGG + Intergenic
918809438 1:189096490-189096512 ACCTCAGAAAATTCAAATTGTGG + Intergenic
919114261 1:193260847-193260869 AGGTAAGATCATTCATCTTGAGG + Intergenic
919885080 1:201927694-201927716 AGGTGAGATGATCCACCTTGAGG + Intronic
920463840 1:206164623-206164645 AGGTCAGGTAATGAAAATTGGGG - Intergenic
920514971 1:206578540-206578562 GTGTGAGATGATTCAAATCGTGG + Intronic
921241123 1:213184490-213184512 AGGGGAAATAAATCAAATTGAGG - Intronic
921805105 1:219445390-219445412 ATGTAAGTTTATTCAAATTGGGG + Intergenic
922144798 1:222931096-222931118 AGTTTAGATAATTCTAAGTGTGG + Intronic
923202460 1:231725492-231725514 GGGTGAGCTAGTGCAAATTGAGG - Intronic
923995896 1:239494090-239494112 AGGCAGGTTAATTCAAATTGAGG + Intronic
924518027 1:244782268-244782290 GGGTGAGAGAATGCAAACTGAGG - Intergenic
924610586 1:245570266-245570288 AGATGAGAGAATTGAAATTCAGG + Intronic
1064086069 10:12347913-12347935 AGGTTAGATAATACAAACAGTGG - Intergenic
1064466824 10:15591740-15591762 AGGTGAGATACTCCATTTTGAGG - Intronic
1064598156 10:16966859-16966881 AGGAGAGATAATTCACATGGAGG + Intronic
1066717882 10:38306649-38306671 AGGGGAAATAATGTAAATTGGGG - Intergenic
1068895985 10:62202280-62202302 AGGTGAGATAATTAGAACTCAGG - Intronic
1069180490 10:65352507-65352529 AGGTGGGACAACTCAAAGTGGGG - Intergenic
1069884835 10:71617089-71617111 AGATGGGATCATTCACATTGAGG + Intronic
1071274383 10:84039551-84039573 AGGTGGGACAACTCAAAGTGAGG + Intergenic
1073819850 10:107249320-107249342 AGGTGGGACAACTCAAAGTGGGG - Intergenic
1073915172 10:108394744-108394766 AAATGAGATAGTTCATATTGTGG + Intergenic
1074421440 10:113312518-113312540 AGGAGAGATTATACAGATTGAGG + Intergenic
1074619732 10:115106523-115106545 AGGAGATACAATTCAAACTGAGG - Intronic
1074647789 10:115482391-115482413 ATGTAAGATAATGTAAATTGTGG + Intronic
1075366186 10:121892326-121892348 AGGTAAGATAATTAAATTTGGGG - Intronic
1075424248 10:122329137-122329159 AAGTGAGAAAATGCATATTGAGG + Intronic
1075813997 10:125250323-125250345 AGGTGAGATCATCCAAGATGAGG - Intergenic
1077973907 11:7225458-7225480 AGGAGAGATTACTCAAATTTTGG - Intergenic
1078845831 11:15117734-15117756 AGATGACATATTTGAAATTGAGG - Intronic
1080307186 11:30849407-30849429 AGGTGAGAGAATTGACATTTGGG + Intronic
1080989467 11:37513306-37513328 GGGTGAGATATATCAAATTGTGG - Intergenic
1081172607 11:39887325-39887347 AGCTGAGATAATTTATATTTTGG + Intergenic
1082959940 11:58908868-58908890 AAATGAGATAATTCAAATGATGG - Intronic
1083915721 11:65742395-65742417 GCGTGAGTCAATTCAAATTGAGG + Intergenic
1084879179 11:72158103-72158125 AGGTGGGACAATTCAAAGTGGGG - Intergenic
1085153651 11:74272912-74272934 AGGTGAGATGATACAGACTGGGG + Intronic
1085185764 11:74574884-74574906 AGGTGACTTAATACAAATTTTGG + Intronic
1086127977 11:83369314-83369336 AGGTGGGACAACTCAAAGTGGGG + Intergenic
1086314044 11:85570814-85570836 AGTTGAGATTATGCAATTTGAGG - Intronic
1086693638 11:89818271-89818293 AGGTAATATAATACAAAATGGGG - Intergenic
1086712508 11:90026298-90026320 AGGTAATATAATACAAAATGGGG + Intergenic
1087219009 11:95525945-95525967 GGAGGAAATAATTCAAATTGTGG + Intergenic
1087693246 11:101346351-101346373 AAGAGAAATAATTCATATTGTGG - Intergenic
1088063084 11:105680846-105680868 AGGTGAGTTACTTGTAATTGTGG - Intronic
1088208438 11:107423272-107423294 ATGTGAAAGAATGCAAATTGAGG - Intronic
1088212871 11:107475667-107475689 AGGTGGGACAATTCAAAGCGGGG - Intergenic
1088697022 11:112376035-112376057 AGTTCAGATACTTCAAAATGTGG + Intergenic
1089042039 11:115461379-115461401 AGGTGAGAAACTGCAAACTGTGG + Intronic
1090100274 11:123788093-123788115 AGGTGGGACAACTCAAAGTGGGG + Intergenic
1090681912 11:129068850-129068872 TGATGAGATACTGCAAATTGAGG - Intronic
1091362731 11:134990957-134990979 ATGTGAAATATTTCAAAGTGGGG - Intergenic
1091655914 12:2346880-2346902 AGGTGAGATGGTTCAAATCATGG - Intronic
1093057641 12:14570587-14570609 AGGCGAGACAACTCAAAGTGGGG - Intergenic
1095331978 12:40977137-40977159 AGGTGGGACAACTCAAAATGGGG + Intronic
1096795273 12:54073210-54073232 AGGTGGCATAATACAAATTTGGG - Intergenic
1098408978 12:70158726-70158748 AGGTGAGACAACTCAAAGTGGGG - Intergenic
1098958129 12:76708823-76708845 ATGGGAGATATTTCAAAATGGGG + Intergenic
1099419658 12:82441163-82441185 GCTTGAGATAATTCAAAATGGGG - Intronic
1100121422 12:91373382-91373404 AGGAGGGACAATTCAAAGTGGGG - Intergenic
1101262048 12:103043502-103043524 AGGTGAAATAATCCAAATACGGG - Intergenic
1101390140 12:104292810-104292832 TGATGAGATAATTAGAATTGCGG + Intronic
1102444513 12:112991548-112991570 AAGTGGGACAATTCAAAGTGGGG + Intronic
1103528643 12:121584279-121584301 AGGTGAGTTAAAACAAATTCTGG + Intergenic
1104510964 12:129377397-129377419 AGGTGTCATAATTCAAGATGGGG + Intronic
1105681741 13:22735671-22735693 AGGTGAGATATTTCCAGTAGAGG + Intergenic
1105788746 13:23775801-23775823 AGAAGAGATAAATCAAATGGAGG + Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1106429110 13:29662715-29662737 AGGTGGGACAACTCAAAGTGGGG - Intergenic
1106712633 13:32354465-32354487 AGGTGGGATAATTGAAAGAGGGG + Intronic
1106944801 13:34815349-34815371 AAGTGAGATCATTAAAAGTGAGG - Intergenic
1107155950 13:37167065-37167087 AGGTGGGACAACTCAAAGTGGGG - Intergenic
1108048451 13:46405723-46405745 AGGTGGGCTAATGCAAATTTAGG - Intronic
1108207925 13:48109502-48109524 AGGTGAGACAAATAAAATTCTGG - Intergenic
1108415738 13:50196614-50196636 AGGTCAAATAATTCAACTTAAGG + Intronic
1109570332 13:64179868-64179890 AGGTGAGACAACTCGAAGTGGGG + Intergenic
1111115179 13:83767092-83767114 AAGTGAGATATTTTAAATTGGGG + Intergenic
1111241971 13:85485529-85485551 AGGTTAGACAATTCATACTGAGG + Intergenic
1111287954 13:86119865-86119887 AGGTGGGACAACTCAAAGTGGGG + Intergenic
1114056380 14:18971175-18971197 AGCTGAGAGATTTAAAATTGGGG + Intronic
1114106170 14:19430552-19430574 AGCTGAGAGATTTAAAATTGGGG - Intronic
1114705361 14:24720925-24720947 AGGAGAGATTATTCAAATTTTGG + Intergenic
1115244422 14:31280605-31280627 AGGCGGGATAACTCAAAGTGTGG - Intergenic
1115932358 14:38510651-38510673 AGGTGAGACAACTCAAAGTGGGG - Intergenic
1117446246 14:55806260-55806282 AGGTGAGACAACTCAAAGCGGGG + Intergenic
1118524778 14:66626769-66626791 ATGATAGATAATTCAATTTGAGG + Intronic
1119200307 14:72747127-72747149 AGGTGAGAGAAATCAGACTGTGG - Intronic
1120671789 14:87371057-87371079 AAGTGAAATAATTCTCATTGAGG + Intergenic
1121765210 14:96479946-96479968 AGGAGAGCTAATTCCAATTGTGG + Intronic
1123499037 15:20863067-20863089 AGCTGAGAGAATCAAAATTGGGG - Intronic
1123556271 15:21436686-21436708 AGCTGAGAGAATCAAAATTGGGG - Intronic
1123592511 15:21874032-21874054 AGCTGAGAGAATCAAAATTGGGG - Intergenic
1123695023 15:22872824-22872846 AGATGAGATTATTAAAAATGTGG - Exonic
1125421390 15:39508193-39508215 AGGGGACATAATACAAATTATGG - Intergenic
1126193024 15:45898808-45898830 AGGTGAGAGGAATCACATTGTGG + Intergenic
1126645017 15:50867201-50867223 AGGTGGGATAACTCAAAGCGGGG + Intergenic
1126874275 15:53022845-53022867 GGGTGATAAAATTCAAATTGAGG - Intergenic
1128320445 15:66690049-66690071 GGGTGAGATAATTCCAAATGAGG - Intergenic
1128859975 15:71061066-71061088 AGGTGAGATGATACTCATTGTGG + Intergenic
1130074485 15:80676891-80676913 AGGTGGGACAACTCAAAATGGGG - Intergenic
1202964612 15_KI270727v1_random:163889-163911 AGCTGAGAGAATCAAAATTGGGG - Intergenic
1132596586 16:753834-753856 AGGTGGGATATCTCAAAGTGGGG - Intronic
1134397120 16:13875298-13875320 AGGCGAGACAACTCAAAGTGGGG - Intergenic
1137083904 16:36099062-36099084 AGGTAAGCTACTTTAAATTGTGG - Intergenic
1138316637 16:56075966-56075988 ATGAGAGAGAATTCAGATTGAGG - Intergenic
1138898507 16:61240102-61240124 AGGTGGGACAATTCAGAGTGGGG - Intergenic
1138995394 16:62445568-62445590 AGGCGAGACAATTCAAAGTGTGG - Intergenic
1139064611 16:63297412-63297434 AGGTGATATAATTCACACTAAGG + Intergenic
1139287070 16:65825305-65825327 AGTTGACCTAATTGAAATTGAGG - Intergenic
1140697679 16:77551086-77551108 AGGTGAGTTGCTTAAAATTGTGG - Intergenic
1141209269 16:81960997-81961019 AGGTGTAAAAATTCAAAATGTGG + Exonic
1141508738 16:84498813-84498835 AGGTGAGTTTATTCAAATACAGG - Intronic
1141915256 16:87092095-87092117 AGGTAAAATAATTCACCTTGGGG - Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1142923419 17:3211299-3211321 AGGAGAGATAAGACAATTTGAGG - Intergenic
1143347539 17:6261037-6261059 AGGTTAGATATATCGAATTGGGG - Intergenic
1144061767 17:11589330-11589352 AGGTGAGATATTTTGAAGTGGGG - Intergenic
1144300006 17:13914309-13914331 AGGTGGGACAAATCAAAGTGGGG - Intergenic
1144303056 17:13941310-13941332 AGGTGAGTCAATGCAAATTGAGG + Intergenic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1144518248 17:15935753-15935775 AATTGAGATAATCCAATTTGAGG - Intergenic
1145021853 17:19438153-19438175 AGGTGAGACAACTCAAAGAGGGG - Intergenic
1146074107 17:29712087-29712109 AGGCGAGATAACTCGAAGTGGGG + Intronic
1152045932 17:77935731-77935753 AGGTGGGACAACTCAAAGTGGGG + Intergenic
1154457080 18:14539813-14539835 AGCTGAGAGAATCAAAATTGGGG - Intronic
1155787396 18:29917689-29917711 AGTTGAGATAAGGCAAGTTGTGG - Intergenic
1157623973 18:49033475-49033497 AGGTCAGATAAATCAGATTACGG - Intergenic
1157833952 18:50881921-50881943 TGATGAGAAAATGCAAATTGGGG + Intronic
1158084593 18:53635822-53635844 AGGTGGGACAATTCAAAGTGTGG - Intergenic
1159337062 18:67081956-67081978 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159337072 18:67082029-67082051 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159653501 18:71004695-71004717 AGGTGGGACAACTCAAAGTGGGG + Intergenic
1159786319 18:72718671-72718693 AGGTGGGACAACTCAAAGTGGGG - Intergenic
1160320314 18:77885745-77885767 AGGGGAAATAATGCAAATAGGGG + Intergenic
1160379810 18:78445448-78445470 GGGTGAAAGAATTAAAATTGAGG + Intergenic
1163882173 19:19934785-19934807 ACATGAGATAATTCATACTGGGG + Exonic
1164966945 19:32493421-32493443 AGGTGGGACAACTCAAAGTGGGG + Intergenic
1165379847 19:35471337-35471359 AGATGGGACAATTCAAAGTGGGG - Intergenic
1166418298 19:42612285-42612307 AGGTGGGACAATTCAAAGTGGGG - Intronic
1167893954 19:52565774-52565796 AGGTGAAATAACTGGAATTGCGG - Intronic
1168190513 19:54735186-54735208 ATGTGAGACAATTCATATAGAGG + Intronic
925176400 2:1787215-1787237 AGGTGGGACAACTCAAAGTGGGG - Intergenic
925438597 2:3864123-3864145 ATATGAAATCATTCAAATTGTGG + Intergenic
925725005 2:6864072-6864094 CAGTGAGATAATGCACATTGAGG - Intronic
925869204 2:8254600-8254622 AGGTGGGATAACTCAAAGTGGGG - Intergenic
928590167 2:32806442-32806464 AAGTCAGAAAATTCAAATTCTGG - Intronic
928727296 2:34189478-34189500 AGGAAATATAAGTCAAATTGTGG - Intergenic
928863449 2:35888250-35888272 AGGTAAGATAATTGTAATAGTGG - Intergenic
929264952 2:39908013-39908035 ATGTGAGATATTTAAAAGTGAGG - Intergenic
932727545 2:74192504-74192526 AGATGGGACAATTCAAAGTGGGG + Intergenic
933155128 2:78964836-78964858 AGGTGAGACATCTCAAAGTGGGG + Intergenic
933375070 2:81468516-81468538 AGGTAAGAAAATTCAAACAGGGG - Intergenic
933459146 2:82557484-82557506 TGGTGAGTTTATTGAAATTGAGG + Intergenic
934755950 2:96824994-96825016 AGGGGAGATGAATCAAACTGGGG + Intronic
935024946 2:99268047-99268069 AGGTGGGACAACTCAAAATGGGG - Intronic
936956361 2:118026548-118026570 AGGTGGGACAACTCAAAGTGGGG + Intergenic
937943209 2:127306146-127306168 AAGTGATGTAATGCAAATTGAGG - Exonic
938336568 2:130505451-130505473 AGCTGAGAGATTTAAAATTGGGG - Intronic
938353250 2:130615211-130615233 AGCTGAGAGATTTAAAATTGGGG + Intronic
938991755 2:136636720-136636742 AGGGGAGATAATTCAAAATAGGG - Intergenic
940023108 2:149176966-149176988 AGGTAAGACATTTCAAAGTGAGG - Intronic
941095248 2:161232896-161232918 AGGTTAGATAATTGATATTTTGG + Intronic
941252373 2:163181970-163181992 AGGGGAGCTTATTAAAATTGTGG + Intergenic
941540157 2:166772086-166772108 AGGTGGGACAACTCAAAGTGGGG - Intergenic
941911295 2:170767581-170767603 AGTTGAAAAATTTCAAATTGGGG + Intergenic
943309304 2:186307093-186307115 AGGTAAGACAACTCAAAGTGGGG - Intergenic
943794239 2:191971897-191971919 AGGTGATAAAAGTCATATTGAGG + Intronic
943972927 2:194433884-194433906 ACATCAGATAACTCAAATTGAGG + Intergenic
944246147 2:197532372-197532394 TGGTTAAATAATTAAAATTGGGG + Intronic
944906748 2:204269509-204269531 AGGGGTGACAATTCACATTGAGG + Intergenic
945675939 2:212855731-212855753 AAGTGGGATATTTCAAATGGAGG - Intergenic
946682914 2:222236235-222236257 AAATGAAATGATTCAAATTGGGG - Intronic
947406731 2:229786100-229786122 AGTTCAGAAAATTCAAGTTGGGG + Intronic
1169730530 20:8780812-8780834 AGGTGAGAAAATTGACATTCAGG - Intronic
1170564338 20:17588275-17588297 AGGTGGGATAACTCAAACAGGGG - Intronic
1171254959 20:23683742-23683764 AGGAGAGATAAATCCAATGGAGG - Intergenic
1174143469 20:48433636-48433658 AGGTGGGACAACTCAAAGTGGGG - Intergenic
1174913925 20:54635579-54635601 AGGTGAGACAACTCCAAATGGGG - Intronic
1176817078 21:13613524-13613546 AGCTGAGAGAATCAAAATTGGGG + Intronic
1177589660 21:23146035-23146057 AGGTGGGACAACTCAAAATGGGG + Intergenic
1178026796 21:28477635-28477657 GGGTGAGGTAATGCAAATTGAGG - Intergenic
1178386903 21:32159727-32159749 AGGTGGGACAACTCAAAGTGGGG + Intergenic
1178516783 21:33254720-33254742 AGGTGGGACAATTCGAAGTGGGG - Intronic
1179260007 21:39749693-39749715 AGGTGGGACAATTCCAAGTGGGG + Intronic
1179505467 21:41836926-41836948 AGGTGTGGTTATTCTAATTGAGG - Intronic
1179915061 21:44471751-44471773 AGGTGGGACAACTCAAAGTGGGG - Intergenic
1180135051 21:45856870-45856892 AGGTGGGACAACTCAAAGTGAGG + Intronic
1180474866 22:15693786-15693808 AGCTGAGAGATTTAAAATTGGGG + Intronic
1182708267 22:32303282-32303304 AGGTGGGACAACTCAAAGTGGGG + Intergenic
1182909982 22:33975020-33975042 TGGTGAGAACATTCAAATTTTGG - Intergenic
1183662945 22:39232073-39232095 AAGTGAGAAAATTCAGAGTGTGG + Intronic
1184364810 22:44043822-44043844 AGGTGAGATCTTTCACCTTGGGG + Intronic
1184395965 22:44240766-44240788 AGGTGGGACAACTCAAAGTGGGG + Intergenic
951641655 3:24843413-24843435 AGGTGAGAAAATGTAAATTCAGG - Intergenic
952799231 3:37272563-37272585 AGGTGTGATAAATAATATTGTGG - Intronic
952862645 3:37826830-37826852 AGGTCAGATAATTCCATTTTGGG - Intergenic
953831916 3:46306396-46306418 AGGTGGTATATTTTAAATTGGGG + Intergenic
953961719 3:47271216-47271238 AGGTGAGATAATAAAACCTGAGG - Exonic
955659879 3:61287068-61287090 AGAGGAGATAAATAAAATTGAGG + Intergenic
955796354 3:62641433-62641455 AGGTGATATATTTCAAAGGGTGG - Intronic
956477935 3:69643029-69643051 AGGGAAGAAAATTCAAATTCTGG - Intergenic
956731432 3:72200226-72200248 AGGTGGGACAACTCAAAGTGGGG + Intergenic
957063124 3:75498451-75498473 AGGTGAGACAACTCGAAGTGGGG - Intergenic
958617003 3:96506878-96506900 TGGGGAAATAATTCAAAGTGAGG - Intergenic
959176184 3:102914096-102914118 AGGAAAGGTAAGTCAAATTGTGG - Intergenic
959557333 3:107736696-107736718 GAGTGATATAATTCAGATTGTGG + Intronic
960745870 3:120887720-120887742 AGGATAGATAGTTCAAATTGTGG - Intergenic
961363353 3:126382133-126382155 AGCTGAGATGATTCAAAGTCTGG + Intergenic
964818769 3:160746701-160746723 AGGTGAGCTAATTCAAAATTAGG + Intergenic
964932328 3:162042059-162042081 AGGTGAATTAATTTAAATTAGGG - Intergenic
964986676 3:162750201-162750223 AGGTCAGATATTTTATATTGAGG + Intergenic
966227893 3:177617814-177617836 AGGTCAAATAATTCAGACTGCGG + Intergenic
967636343 3:191806451-191806473 AGGTGGGACAACTCAAAGTGGGG - Intergenic
969007011 4:4028464-4028486 AGGTGAGACAACTCGAAGTGGGG - Intergenic
969805957 4:9608993-9609015 AGGTGAGACAACTCAAAGCGGGG + Intergenic
974589418 4:63924386-63924408 CAGTGAGCTATTTCAAATTGTGG + Intergenic
975906913 4:79224211-79224233 AGGTGACATAATTCCAAGGGCGG + Intergenic
977135225 4:93295561-93295583 AGGAGATATAATTCCACTTGTGG - Intronic
977343496 4:95790130-95790152 AGGTGGGACAATTCAAAGTGGGG + Intergenic
977454123 4:97235920-97235942 AGGGGAGAGAAGTGAAATTGGGG + Intronic
977690077 4:99895778-99895800 AGGTGAGAGAATTAAGATAGGGG - Intergenic
977894325 4:102346391-102346413 AGGTGAGACAATTGGAAGTGGGG - Intronic
977935676 4:102801256-102801278 AGTTGTTAAAATTCAAATTGTGG - Intronic
978356834 4:107884723-107884745 AGGTGGGACAACTCAAAGTGGGG - Intronic
978357527 4:107892665-107892687 AGGTGGGACAACTCAAAGTGGGG + Intronic
979848344 4:125545380-125545402 AGGTGGGACAACTCAAAGTGGGG + Intergenic
979957996 4:126979492-126979514 AGGTGAGAGAATTAACATAGAGG + Intergenic
980164647 4:129210501-129210523 GGGTGAGAAAAGTAAAATTGTGG + Intergenic
981422926 4:144571882-144571904 AGGTGGGACAACTCAAAGTGCGG - Intergenic
982464562 4:155713951-155713973 GTGTGAGATAATTCAAAGTATGG + Intronic
982569851 4:157034844-157034866 AGCTGAGATACTCCAAAATGTGG - Intergenic
982654319 4:158128473-158128495 AGTTGAGAAATGTCAAATTGGGG - Intronic
983746193 4:171203289-171203311 AGGTGACATAATTAAAAATTTGG - Intergenic
984435948 4:179710346-179710368 AGGTTAGAAAATGCAAACTGAGG + Intergenic
984479760 4:180284619-180284641 AGGTGAGAATATTCACAGTGGGG + Intergenic
984498724 4:180531892-180531914 AGGTGAGATCATCCACATTCTGG + Intergenic
984848158 4:184125463-184125485 AGGTGAGGTAAGTAAAAGTGGGG + Intronic
985839936 5:2298612-2298634 AGATGAGATCATCCAAATTTAGG + Intergenic
986201808 5:5586057-5586079 TGGTGAGTAAATGCAAATTGAGG + Intergenic
986429200 5:7664992-7665014 AGGTGGGACAACTCAAAGTGAGG - Intronic
987096597 5:14556072-14556094 AGGTGGGATAACTCAAAGTGGGG + Intergenic
990835099 5:60009913-60009935 AATTGAGATAATTTAAATTTTGG + Intronic
992524973 5:77600351-77600373 AAGTGAGATCATTCAATATGTGG - Intronic
992607112 5:78469494-78469516 AGGTAACAAAATTAAAATTGGGG - Intronic
992664533 5:78994104-78994126 ATATGAGATGATTAAAATTGGGG + Intergenic
993256177 5:85592519-85592541 GGGAGATATAATTCAAGTTGAGG + Intergenic
993733030 5:91445271-91445293 AGGTGGGACAACTCAAAGTGGGG - Intergenic
994873443 5:105382525-105382547 AGGGCAGATAAGTCAAATTGAGG + Intergenic
994980445 5:106868370-106868392 AGGTGTGATAAATCAAACTTTGG + Intergenic
997023511 5:130030154-130030176 AGGTGAGATAATTCAAATTGTGG - Intronic
998066722 5:139165301-139165323 AGGTGGGACAACTCAAAGTGGGG - Intronic
998323082 5:141250943-141250965 AGGTGAGTTAATGCAAATTGAGG - Intergenic
998727259 5:145031799-145031821 AGGAGGGATAACTCAAATAGGGG - Intergenic
999151629 5:149430229-149430251 AGGTGAGATGAATAAGATTGGGG - Intergenic
999369617 5:151045984-151046006 GGGTGAGATAATTTGTATTGAGG - Intronic
1000073304 5:157761428-157761450 AGAGGAGATAATTCAGAATGTGG - Intergenic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1003664219 6:8094650-8094672 GGGATAGATAATTTAAATTGTGG + Intronic
1004258920 6:14090414-14090436 AGGTGAGAAAGTTCATTTTGAGG + Intergenic
1004647011 6:17571909-17571931 AGGTGGGACAATTCGAAGTGGGG - Intergenic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1006413665 6:33890859-33890881 AGGTGAGACAACTCAAAGTGGGG - Intergenic
1006496827 6:34429613-34429635 AGGTGAGATAACTCAAAGCAGGG + Intergenic
1006675964 6:35763755-35763777 AGGTGAGACAACTCGAAGTGGGG + Intergenic
1008910504 6:56727215-56727237 AGGTGGGACAACTCAAAGTGGGG - Intronic
1010250038 6:73697663-73697685 AGGTAAGATACTGCAAATTTGGG - Intronic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010940179 6:81907488-81907510 AGGTGAGAAAATGCAATTTTTGG + Intergenic
1011942830 6:92864271-92864293 AAATGATATGATTCAAATTGTGG + Intergenic
1012658732 6:101858899-101858921 AAATGATATAATTCAAATTGAGG + Intronic
1013115357 6:107099604-107099626 AAAAGAGATAATTAAAATTGGGG - Intronic
1013610561 6:111790604-111790626 TAGTGAGATAATTCAAAATGTGG - Intronic
1014803057 6:125798334-125798356 AGATGAGAAAACTCAAAGTGTGG - Intronic
1016602452 6:145877876-145877898 AGGTGAGACAACTCAAAGTGGGG - Intronic
1016655860 6:146517685-146517707 TGTTGAGATAATGAAAATTGAGG + Intergenic
1018441488 6:163817551-163817573 AGGAGATAGAATTCAAGTTGGGG + Intergenic
1019107052 6:169676781-169676803 AGGTGGGACAGTTCAAAGTGGGG - Intronic
1019122954 6:169819388-169819410 AGGTGGGACAACTCAAAGTGGGG - Intergenic
1019123208 6:169821848-169821870 AGGTGGGACAACTCAAAGTGGGG - Intergenic
1021247603 7:18283019-18283041 AGGGGAGATATTTCATAGTGGGG + Intronic
1023682227 7:42699161-42699183 ACGTGAAATAATTTAAAATGCGG + Intergenic
1023714326 7:43028303-43028325 AGGTGAGATAATTGCAATAATGG - Intergenic
1024035194 7:45502110-45502132 AGGTGGGACAACTCAAAGTGGGG - Intergenic
1024050472 7:45618656-45618678 GGGTGAGATGATTCTCATTGTGG - Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1026308728 7:69166068-69166090 AGGTGGGACAACTCAAAGTGGGG + Intergenic
1026513590 7:71047906-71047928 AGGTATGAAAACTCAAATTGAGG + Intergenic
1027659650 7:80974250-80974272 ATGTGAGAAAATTCAAAATATGG - Intergenic
1033162883 7:139012896-139012918 AGGAGGGATAATTCAAAGAGCGG - Intergenic
1033563191 7:142553595-142553617 ATGTGAAATACTTGAAATTGGGG - Intergenic
1033582792 7:142752092-142752114 AGGTGAGAGGATTCAAGTTAAGG - Intronic
1033584349 7:142763012-142763034 AGGTGAGAGGATTCAAGTTAAGG - Intronic
1033680604 7:143591716-143591738 AGGAGAGATAACACAAATTATGG + Intergenic
1033704289 7:143870096-143870118 AGGAGAGATAACACAAATTATGG - Intronic
1034055081 7:148025771-148025793 AGATGAGATAAATGAATTTGGGG - Intronic
1036289278 8:7473181-7473203 AGGTGGGACAATTCAAAGTGGGG + Intronic
1036332203 8:7838351-7838373 AGGTGGGACTATTCAAAGTGGGG - Intronic
1038178717 8:25206051-25206073 AGCAGAGATTATTCTAATTGAGG + Intronic
1041153301 8:54958139-54958161 AGGTGAGATGATTCAGGTTTGGG - Intergenic
1042198152 8:66252073-66252095 AGGTCAGACAACTCAAAGTGGGG + Intergenic
1044396524 8:91719937-91719959 AGGTGGGACAGCTCAAATTGGGG + Intergenic
1046082141 8:109382708-109382730 ATGGAAGATAATTTAAATTGAGG - Intronic
1046222596 8:111235487-111235509 AGGTGGGAAAACTCAAAGTGGGG - Intergenic
1046490729 8:114950385-114950407 AAGTGAGATAATACATATAGAGG - Intergenic
1046516059 8:115262400-115262422 AGGTGAGACTATTTAAACTGGGG - Intergenic
1048187597 8:132256287-132256309 AATTGAGATTATTCAAATTGAGG + Intronic
1048778005 8:137968792-137968814 AGGTGGGACAACTCAAAGTGGGG - Intergenic
1048895594 8:138989570-138989592 AGGTGAGATGGTTCATATTGGGG + Intergenic
1049333629 8:142069933-142069955 TGGTGGGAAAATTCAAATGGTGG - Intergenic
1050802450 9:9632625-9632647 AGGAGAGATAGTTCAAATGTTGG + Intronic
1050929189 9:11302333-11302355 GGGAGATACAATTCAAATTGAGG + Intergenic
1051679281 9:19590834-19590856 AAGTGGGATGCTTCAAATTGGGG - Intronic
1055018081 9:71640580-71640602 AATTGAGAGAATTCAAATTAAGG - Intergenic
1055489062 9:76786120-76786142 AGATGAGGGAATTCAAATTCTGG - Intronic
1055515236 9:77026852-77026874 AGGTTAGAAAATTGAAATTTAGG - Intergenic
1056882066 9:90404706-90404728 AGCTTAGATAATTCACATAGGGG + Intergenic
1056902064 9:90609076-90609098 AGGTGGGATAACTCAAAGTGGGG + Intergenic
1058638889 9:107064042-107064064 AGGTGGGACAACTCAAAGTGGGG - Intergenic
1059567213 9:115394910-115394932 ATGTGAGAGTTTTCAAATTGGGG + Intronic
1203530283 Un_GL000213v1:135967-135989 AGCTGAGAGAATCAAAATTGGGG - Intergenic
1185524018 X:763143-763165 AGGAAAGATAATTCATGTTGGGG - Intergenic
1185552639 X:996033-996055 AGGTGAGACAGCTCAAAGTGAGG + Intergenic
1185575318 X:1167815-1167837 AGGTGAGACAATTCAAACTGGGG - Intergenic
1185805017 X:3049228-3049250 AGGTGAGATAACTCAAAGTGGGG + Intronic
1185805272 X:3051189-3051211 AGGTGACACACTTCAAAGTGGGG - Intronic
1185951905 X:4446638-4446660 AGGTGAGACAATGCAAAGTGGGG - Intergenic
1186812027 X:13199777-13199799 AGGTGAGGTAATTAGAAATGGGG - Intergenic
1187139856 X:16583222-16583244 AGGTGGGACAACTCAAAGTGCGG - Intergenic
1187548004 X:20271209-20271231 ATTTGAGAAAATTCAAATTTTGG + Intergenic
1188065434 X:25653447-25653469 AGGTCAGAGGATGCAAATTGAGG + Intergenic
1189225339 X:39408402-39408424 AGATGAAAGAATTCAAAATGTGG + Intergenic
1189417101 X:40824988-40825010 AGGTGAAATAATTAAATGTGAGG + Intergenic
1190112114 X:47597463-47597485 AGGTGAGATGATCCAATCTGAGG + Intronic
1190251479 X:48730068-48730090 AGCTCAGATAATTCAAATTCTGG + Intergenic
1190389328 X:49916430-49916452 AGGTGGTATTATTCAAAGTGTGG + Intergenic
1190498107 X:51046681-51046703 AGGTGAGAAGATACAAATAGTGG + Intergenic
1190636158 X:52435985-52436007 AGGAGAGGTCATTCAAATGGAGG + Intergenic
1191157340 X:57288134-57288156 AGATGATATATTTCAAATTTTGG + Intronic
1193259923 X:79393261-79393283 AGGCCAGAGAATTAAAATTGGGG - Intergenic
1193486681 X:82092187-82092209 AGGTGGGACAACTCAAAGTGGGG + Intergenic
1193716331 X:84938960-84938982 AGGTGGGACAATTCAAAGTGGGG + Intergenic
1193718310 X:84957867-84957889 AGGTGGGACAACTCAAAGTGGGG + Intergenic
1193902734 X:87203122-87203144 AGGTGAAATACTTCATAATGAGG + Intergenic
1194044890 X:88990207-88990229 AGGTGGGACAACTCAAAGTGGGG - Intergenic
1194199078 X:90933306-90933328 AGGTGAGACAACTCAAAGTGGGG - Intergenic
1194256632 X:91643379-91643401 AGGTGGGACAATTCGAAGTGGGG - Intergenic
1194292452 X:92091628-92091650 AGGTGGGACAACTCAAAGTGGGG + Intronic
1194294148 X:92107667-92107689 ACGTGGGACAATTCAAAGTGGGG - Intronic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195718070 X:107837649-107837671 AGGTGAGATGATTGAAATAAAGG + Intronic
1196323884 X:114378088-114378110 ATGTGAAATAATTAAAATTTTGG + Intergenic
1196505612 X:116437532-116437554 AGCTAAGATTATTCAAATTTTGG - Intronic
1197160735 X:123319147-123319169 GGGAGATACAATTCAAATTGAGG + Intronic
1198306456 X:135388562-135388584 AGGTGGGACAACTCAAAGTGGGG - Intergenic
1199385219 X:147215680-147215702 AGGTGGGACAATTCAAAGTAGGG + Intergenic
1199712591 X:150480848-150480870 AGGTGGGATAATTCCTAGTGAGG - Intronic
1200545075 Y:4509738-4509760 AGGTGAGACAACTCAAAGTGGGG - Intergenic
1200575349 Y:4882641-4882663 AGGTGGGACAATTCGAAGTGGGG - Intergenic
1200609962 Y:5316204-5316226 AGGTGGGACAACTCAAAGTGGGG + Intronic
1200611655 Y:5332187-5332209 AGGTGGGACAACTCAAAGTGGGG - Intronic
1201738543 Y:17298456-17298478 AGGTGAGACAATGCCAAGTGGGG - Intergenic
1202173817 Y:22079336-22079358 AGGTGAAAGAATTCAACTGGTGG + Intronic
1202217543 Y:22507046-22507068 AGGTGAAAGAATTCAACTGGTGG - Intronic
1202257106 Y:22932868-22932890 AAGTGACAAAAATCAAATTGTGG + Intergenic
1202325642 Y:23689013-23689035 AGGTGAAAGAATTCAACTGGTGG + Intergenic
1202410097 Y:24566616-24566638 AAGTGACAAAAATCAAATTGTGG + Intergenic
1202460685 Y:25103456-25103478 AAGTGACAAAAATCAAATTGTGG - Intergenic
1202545129 Y:25981041-25981063 AGGTGAAAGAATTCAACTGGTGG - Intergenic