ID: 997030049

View in Genome Browser
Species Human (GRCh38)
Location 5:130117060-130117082
Sequence GTCACCCAGGTGAAGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997030045_997030049 -9 Left 997030045 5:130117046-130117068 CCTACCAATCTCTTGTCACCCAG 0: 1
1: 0
2: 0
3: 11
4: 169
Right 997030049 5:130117060-130117082 GTCACCCAGGTGAAGTTGGATGG 0: 1
1: 0
2: 0
3: 13
4: 184
997030043_997030049 20 Left 997030043 5:130117017-130117039 CCTAATTCTTGCAGTGTATCCTT 0: 1
1: 0
2: 0
3: 17
4: 224
Right 997030049 5:130117060-130117082 GTCACCCAGGTGAAGTTGGATGG 0: 1
1: 0
2: 0
3: 13
4: 184
997030044_997030049 1 Left 997030044 5:130117036-130117058 CCTTTCAGTACCTACCAATCTCT 0: 1
1: 0
2: 0
3: 8
4: 174
Right 997030049 5:130117060-130117082 GTCACCCAGGTGAAGTTGGATGG 0: 1
1: 0
2: 0
3: 13
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997030049 Original CRISPR GTCACCCAGGTGAAGTTGGA TGG Intronic
900758447 1:4454250-4454272 GTCTCCCAGCTGCAGTTGAAGGG + Intergenic
901843673 1:11969060-11969082 GTCACCCAGGTGGAGTGCAATGG + Intronic
902339650 1:15774696-15774718 GTCACACACGTGAAGCAGGAGGG - Exonic
902395459 1:16130129-16130151 GCCACCCAGGTGAAGCTGGTAGG - Intronic
904499338 1:30905188-30905210 GTCACCCAGGGGAGCCTGGAGGG + Intronic
905121917 1:35688901-35688923 GTGGCCCAGGTGAGGCTGGATGG + Intergenic
905217434 1:36418886-36418908 GTCACCCAGGTGAAGTGCAGTGG - Intronic
905616249 1:39402170-39402192 GTCACCCAGGTGGAGTGCAATGG - Intronic
905731487 1:40301849-40301871 GTGATCCAGGAGAAGTGGGACGG - Exonic
905763514 1:40580811-40580833 GTCCCCCAGGTGGAGTGCGATGG - Intergenic
905927472 1:41762189-41762211 GTCCCCCATCTGAAGTTGGGTGG - Intronic
906967894 1:50477108-50477130 GTCACGCAGGTGAATTTGGTTGG + Intronic
907666502 1:56437718-56437740 GTCACCCAAGTGAATTTCCAGGG - Intergenic
911417767 1:97597278-97597300 GTCACCCAGGTAGAGGAGGAGGG - Intronic
912300525 1:108511412-108511434 GCCACAGAGGTGAAGTTGCAGGG - Intergenic
913614254 1:120541155-120541177 GTCACCCAGCTGGAGTGCGATGG - Intergenic
914576015 1:148969744-148969766 GTCACCCAGCTGGAGTGCGATGG + Intronic
914692670 1:150044792-150044814 TTCACCCTTATGAAGTTGGAAGG - Intergenic
915767615 1:158380602-158380624 GTCAACTAGGTCAAGTTGGTTGG - Intergenic
915891911 1:159781113-159781135 AGCACCCAGGAGAAGTTGGGGGG - Exonic
917721840 1:177792996-177793018 GTCCCCCACCTGAAGTTGGGTGG + Intergenic
917793128 1:178512652-178512674 GTAACCCAGGTTAAGTGAGACGG + Intergenic
920972090 1:210751573-210751595 GTCACCCTGGTGTAGTGGGTAGG + Intronic
921063739 1:211608214-211608236 GGCAGCCAGGTGACATTGGAAGG - Intergenic
922508164 1:226139262-226139284 GTCAGCCAAGTTAAGTTGGTTGG - Intergenic
1063184278 10:3636467-3636489 GTCACCCTGATGAAGGTCGAAGG - Intergenic
1068048023 10:51912457-51912479 ATAACCCAGGTGAGGGTGGATGG + Intronic
1068722781 10:60264596-60264618 GTCACACAGGTGAAATGGCATGG - Intronic
1068989046 10:63132642-63132664 GTAACCAAGGTGGAGTTGGGTGG - Intergenic
1069831188 10:71283434-71283456 GTCACCCAGCTGGGGTTTGAGGG + Intronic
1070777040 10:79115794-79115816 GTCACTCACCTGAGGTTGGATGG + Intronic
1073781346 10:106842271-106842293 GTCACCCAGGTGGAGTGCAATGG + Intronic
1074535358 10:114324994-114325016 CTCACCCTGGGGAAGCTGGAAGG - Intronic
1075576425 10:123580877-123580899 GTGGCCCAGGTGAGGCTGGAGGG - Intergenic
1075856962 10:125637946-125637968 ATCACCAAGGGGAAGTTGGAGGG - Intronic
1077030064 11:461504-461526 GCCTCCCAGGTGAGGATGGAGGG - Intronic
1078755607 11:14205951-14205973 ATCAAGCAGGTGAAGATGGATGG - Intronic
1079378901 11:19919452-19919474 GTCAGCCTGGTGAAGTTGACGGG + Intronic
1080227686 11:29978198-29978220 CTCACCCATGTGACTTTGGATGG + Intergenic
1081759162 11:45564967-45564989 GTCACCCAGGGGAAGAGAGATGG + Intergenic
1083817522 11:65144017-65144039 GTCATTCAGGGAAAGTTGGAGGG - Intergenic
1084154703 11:67307085-67307107 GACACCCAGGTGTACTTAGATGG + Exonic
1084242127 11:67828957-67828979 GTCACCCAGCTGAGGAAGGATGG + Intergenic
1084440215 11:69168393-69168415 GCCACCCAGGTAGAGGTGGAGGG - Intergenic
1084568895 11:69948051-69948073 AACACCCAGGTGAACTGGGATGG - Intergenic
1086322183 11:85663165-85663187 GTGAAACAGGTGAAGTTGAATGG - Exonic
1089297876 11:117480841-117480863 GTCAAGCTGGGGAAGTTGGAAGG - Intronic
1090567828 11:128015158-128015180 GCCACAGAGGTGAAGATGGACGG + Intergenic
1090765861 11:129875693-129875715 GTCACCCAGGTTGAGGTGCAAGG + Intronic
1091010342 11:131995515-131995537 GTCAGCCAGGCAAAGTTGTAGGG + Intronic
1091908967 12:4213302-4213324 GTCACCTAAGTGCAGTTGGCTGG - Intergenic
1094139186 12:27163194-27163216 GTCAGCTTGGTGAAGTTGGTAGG - Intergenic
1096074922 12:48797441-48797463 GTCACCCAGCTGAAGTTCAGTGG + Intergenic
1097905534 12:64915389-64915411 GTTAGCCAGGTGAAGGAGGAGGG + Intergenic
1099452949 12:82829813-82829835 GTCAACTAGGTGAAGGTGGGTGG + Intronic
1101526678 12:105537583-105537605 GGAACCCAGGAGAAGGTGGAGGG - Intergenic
1102009210 12:109607640-109607662 GCCAGCCAGGTGAAGTGTGAGGG - Intergenic
1103236750 12:119379330-119379352 GACACCCAGGAGATGTTGAAAGG + Intronic
1104750314 12:131234267-131234289 GTCAGCCAGGAGAAGTTGTCCGG + Intergenic
1108532686 13:51342314-51342336 GTCACCCAGGTATAGGTGGTGGG - Intronic
1109887652 13:68563541-68563563 GTCACCCAGGTTAGAGTGGAGGG + Intergenic
1113035184 13:106040342-106040364 CTTAGCCACGTGAAGTTGGAGGG + Intergenic
1113672251 13:112183152-112183174 GTCACCCAGGTCAAGTGCCACGG - Intergenic
1114732801 14:25012019-25012041 GTCACCCAGGTGCAGTACAACGG + Intronic
1115693325 14:35869483-35869505 GTCACCCAGGTTAAAATGCAGGG - Intronic
1118266361 14:64298340-64298362 GTCACCCATGTGCATTTGGTAGG + Intronic
1118445535 14:65848087-65848109 GTCACCCAGGTGCAATGGCACGG + Intergenic
1122407487 14:101509015-101509037 GTGACCCAGGCCAAGGTGGAGGG - Intergenic
1122499368 14:102186547-102186569 GTCACCCTGGTGAAACCGGAGGG - Intronic
1202895711 14_GL000194v1_random:8159-8181 GACACACGGGTGAGGTTGGAGGG + Intergenic
1124054369 15:26228284-26228306 GTCCCCCATCTGAAGTTGGGTGG + Intergenic
1124377458 15:29137151-29137173 GTCACGCAGGTGGGGTTGGCAGG + Exonic
1125598952 15:40905200-40905222 GTCACCCAGGTGAAGTGCAGTGG - Intergenic
1125605244 15:40936557-40936579 GCCACCCAGGGGAAGCTGGGCGG - Exonic
1125756309 15:42067498-42067520 GTCACCCAGGCCAAGTTCAATGG - Intronic
1125968944 15:43896508-43896530 CTGACACAGGTGAAGTTTGATGG - Intronic
1128118781 15:65130650-65130672 GTCACCCAGGTGAAGGTAATAGG - Intronic
1129296873 15:74604558-74604580 GGCACCCAGCTCAAGCTGGAGGG + Intronic
1129851155 15:78794663-78794685 GTCACCCAGGTTAAGTTATGGGG + Intronic
1133353639 16:5119892-5119914 GTCACCCAGCTGAGGAAGGATGG + Intergenic
1134359739 16:13520140-13520162 GTCACCCACGTGATGTGGGAAGG + Intergenic
1134386149 16:13774458-13774480 GTCAACTAGGTCAAGTTGGTTGG - Intergenic
1135416662 16:22273762-22273784 GTCACCCAGGAGGAGCTGGTAGG + Intronic
1137667610 16:50260924-50260946 GTCACACAGGTGGTGTGGGAGGG + Intronic
1137707453 16:50545377-50545399 GGCACCAGGGTGAAGGTGGAGGG + Intergenic
1137980698 16:53066980-53067002 GTCACCCAGGTGAAGTGCAATGG + Intronic
1139272574 16:65697961-65697983 GTCACCGAGGTGATGTTAGCAGG - Intergenic
1139291717 16:65864455-65864477 GTCCCCCACCTGAAGTTGGGTGG - Intergenic
1140195682 16:72853241-72853263 ATCACCCAGGTGAAGATTCAGGG - Intronic
1143252692 17:5534830-5534852 GTGGCCCAGGTGACATTGGAGGG - Intronic
1144834967 17:18151943-18151965 GGCACCCAGGTGAGGGGGGAAGG + Exonic
1146572062 17:33961481-33961503 TTCAGCCAGGTGGAGTTGGAGGG - Intronic
1146688441 17:34856971-34856993 CTCACCCAGGAGAAGGTGGGGGG + Intergenic
1146688486 17:34857138-34857160 CTCACCCAGGAGAAGGTGGATGG + Intergenic
1147324367 17:39663258-39663280 GTCACCCGTGTGAAGATGAAGGG + Exonic
1150063183 17:62086322-62086344 GCCACCCAGGTCCAGTTGGCTGG - Intergenic
1151431595 17:74067206-74067228 GTAACTCAGGTGAAGTTGGGAGG + Intergenic
1152064353 17:78102262-78102284 GTCACCACGGGGAAGTGGGAAGG + Intronic
1152456282 17:80418304-80418326 TGCAGCCAGGAGAAGTTGGAGGG - Intronic
1154212903 18:12395306-12395328 GTCACCCAGGTGGAGTGCAATGG + Intergenic
1161541328 19:4853171-4853193 GTCACCCAGGTGGAGTGCGGTGG + Intronic
1165439465 19:35816380-35816402 TTCACCCAGGTGAAGAGGCACGG + Intergenic
1167113767 19:47476837-47476859 GTCACCGATGTGGATTTGGATGG - Exonic
1167745261 19:51347027-51347049 GCCTCCCAGGTGACGCTGGAGGG - Exonic
1168615692 19:57835205-57835227 GTCATCCAGGTGAGGTTTAATGG + Intronic
1168621091 19:57880243-57880265 GTCATCCAGGTGAGGTTTAATGG - Intronic
1168701067 19:58439860-58439882 GTCACCCAGCGGAAGTGTGAGGG - Exonic
925254321 2:2469360-2469382 TTCACGGAGGTGAGGTTGGAAGG - Intergenic
925561763 2:5203695-5203717 GTCTCCCAGGTGAAGAGGGTGGG - Intergenic
925623023 2:5812464-5812486 GGCACCCTGGAGAAGCTGGAAGG + Intergenic
926984191 2:18603584-18603606 GTCACCCAGGTGGAGTGCAATGG - Intergenic
928417040 2:31103862-31103884 GTCAACAAAGTGAAGATGGAGGG - Intronic
928890176 2:36195710-36195732 GTCTCCCAGGTGAGGGTGGGAGG + Intergenic
929154476 2:38777066-38777088 GTCACCCAGGTGGAGTGCAAAGG - Intronic
931309258 2:61063378-61063400 GTCACCCATATTAACTTGGAAGG - Intergenic
931629055 2:64283211-64283233 GCAGCCCAGGTGAGGTTGGAAGG + Intergenic
938530193 2:132177191-132177213 GTCACCCAGGTGGAGTGCAATGG + Intronic
939928393 2:148201743-148201765 GTCCCCCACCTGAAGTTGGGTGG + Intronic
940858400 2:158747940-158747962 GCCAACCTGGTGAAGATGGAAGG - Intergenic
941117927 2:161493151-161493173 GACACTCAGGTAAAGTTGGATGG + Intronic
942097539 2:172547921-172547943 GTCCCCCACTTGAAGTTGGGCGG - Intergenic
942237364 2:173924652-173924674 GTCACACAGTTGAAAATGGATGG + Intronic
944144753 2:196495105-196495127 GTCACCCAGGTGGAGTGCAATGG + Intronic
944396529 2:199273948-199273970 GTCATCCAGCTGAAGCTGTAAGG - Intronic
944512529 2:200478941-200478963 GTCACCCAGGTGGAGTGCAATGG + Exonic
948143582 2:235692295-235692317 GGCACCCTGGGGAAGATGGAAGG - Intronic
1168759188 20:337341-337363 GGCACCCACAGGAAGTTGGAGGG - Intergenic
1170812735 20:19687270-19687292 CACATCCAGGTGAAGGTGGAGGG - Intronic
1172771119 20:37383264-37383286 GTCACCCTGGTGAAGTGGCCAGG + Intronic
1173751487 20:45480157-45480179 GTCACCCAGGCGGAGGTGAAGGG + Intronic
1179302153 21:40122104-40122126 GTCACACAGGTGTTGTTAGATGG - Intronic
1179818706 21:43923944-43923966 GTCACTCAGGTGAGATTGAAAGG + Intronic
1180186154 21:46140363-46140385 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186194 21:46140563-46140585 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186205 21:46140614-46140636 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186217 21:46140664-46140686 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186236 21:46140764-46140786 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186262 21:46140914-46140936 GTGAGCCACGTGAAGGTGGACGG - Intronic
1181016432 22:20071758-20071780 GTCCCCCAGGTGAAGATGTCCGG - Intergenic
1182402018 22:30085712-30085734 GTCACCCAGGTGAAGTGCAGTGG - Intronic
1183081784 22:35461458-35461480 GTCACCCAGGTGAGAGTGGGTGG + Intergenic
1184060090 22:42076334-42076356 GTCACCCAGGTGGAGTGCAATGG + Intronic
1184300335 22:43555162-43555184 CTCACCCAGGGCAAGTTGCAGGG + Intronic
953847369 3:46438406-46438428 GTCACCCATAAGAAGTTGTATGG - Intronic
954036452 3:47853518-47853540 GTCTCCCAGGTGAGGTGGGGTGG - Intronic
954891860 3:53937907-53937929 GGCACCCAGCTGATGGTGGAAGG + Intergenic
960301373 3:116006612-116006634 GTCATCTAGGTGAAGATGGATGG - Intronic
964472338 3:157068706-157068728 CTCACACAGGTGAAGCAGGACGG + Intergenic
965751471 3:171979102-171979124 GTCTCCCATGTGAAGTAGAAGGG + Intergenic
968503339 4:961104-961126 GCCACCCCGGTGCAGGTGGACGG - Exonic
968561674 4:1286532-1286554 GTCCCCCACCTGAAGTCGGATGG + Intergenic
973218719 4:47700839-47700861 GTCACCCAGGTTGAGTGGCATGG - Intronic
981065648 4:140481906-140481928 GTCACTCAGGTAAAGCAGGAAGG + Intronic
981809525 4:148757904-148757926 GTCATCCAGGTGAAGGTCAATGG + Intergenic
983789743 4:171782270-171782292 GTCACCCAGGTGAAGTGTAGTGG + Intergenic
983989004 4:174095440-174095462 GTCACGCAGGTGAAGTGTGGTGG - Intergenic
985652081 5:1111966-1111988 GGCACCACGGTGAAGTTGGTGGG + Exonic
986989493 5:13535199-13535221 GACAGCCAGGTGAGGATGGAAGG - Intergenic
988787540 5:34578644-34578666 GGCACCCATGAGAAGCTGGAAGG - Intergenic
989457837 5:41663172-41663194 GTTACCCTGGTGAAGGTGGGAGG + Intergenic
993484661 5:88468123-88468145 GACCACCATGTGAAGTTGGAGGG - Intergenic
997030049 5:130117060-130117082 GTCACCCAGGTGAAGTTGGATGG + Intronic
998738649 5:145173434-145173456 TTCACCCAGCTGAAGATGCATGG - Intergenic
999400072 5:151257685-151257707 GGGACCCAGATGAGGTTGGAGGG - Intronic
999971473 5:156868162-156868184 GTCACTCAGATGAAGCTGGCTGG + Intergenic
1001115639 5:168937098-168937120 CTCAACCAGGTGAAGTTGGGGGG + Intronic
1001417254 5:171554836-171554858 TTCTCCCCGGTGAAGTGGGAAGG - Intergenic
1002175001 5:177396738-177396760 GTGACCCAGGTGAAGGGGGCAGG - Exonic
1005012338 6:21347857-21347879 GTCACCCAGGTGTAGTGCAATGG - Intergenic
1007777003 6:44229463-44229485 GCCACTCAGGTGAGGCTGGAGGG + Exonic
1012107848 6:95188176-95188198 GTCATCCAGATGAAGTATGATGG - Intergenic
1026394814 7:69940746-69940768 GTAATCCAGGTGAAGGAGGATGG + Intronic
1027018146 7:74792104-74792126 GTCACCCAGGTGGAGTACAATGG + Intergenic
1027069882 7:75153814-75153836 GTCACCCAGGTGGAGTACAATGG - Intergenic
1032132569 7:129242675-129242697 GTCACCCAGGTGGAGTGCAATGG - Intronic
1033285666 7:140038758-140038780 GTGACCCAGGAGAACTAGGATGG - Intronic
1034165422 7:149021704-149021726 ATGTCCCAGGGGAAGTTGGAGGG + Intronic
1037735275 8:21560914-21560936 GACACCCAGCTGAGGCTGGAGGG - Intergenic
1039133297 8:34292373-34292395 GAAACCCAAGTGAAGTTGGAGGG + Intergenic
1042131023 8:65586867-65586889 GTCACCTAGGTCAAGTGAGAAGG - Intergenic
1042352396 8:67790578-67790600 GTCACCCAGGTTAAGTAGAGTGG + Intergenic
1046049951 8:109010923-109010945 GTCATCCAGGTGAAGATATATGG - Intergenic
1049142618 8:140969838-140969860 GTCACACAGGTGAATATAGAAGG - Intronic
1049337510 8:142094286-142094308 GTCACACAGCTGCAGGTGGAGGG - Intergenic
1050569551 9:6923147-6923169 GGCCCCCAGGTGAAGTGGGGAGG - Intronic
1051491787 9:17674686-17674708 GTCGCCCAGCTGAAGGTAGAAGG + Intronic
1052989768 9:34512358-34512380 GTCATCAAGCTGAAGGTGGAAGG + Exonic
1057184212 9:93047684-93047706 GTCACCCAGGTGGAGTGCAATGG + Intergenic
1057855887 9:98600402-98600424 GTCACCCAGGTGGAGATGTGTGG - Intronic
1059445817 9:114337192-114337214 GTCGCCCAGGTCGAGCTGGATGG + Exonic
1060039118 9:120284491-120284513 GTGACTCAGGTGAGGTTGGCAGG + Intergenic
1060351290 9:122862853-122862875 GTCACCCAGGTGGAGTGCAATGG - Intronic
1060529373 9:124339495-124339517 GGCACAGAGGTGAGGTTGGAGGG - Intronic
1061436197 9:130563714-130563736 GTCACCCAGGTGGAGTGCAATGG + Intergenic
1189619351 X:42818908-42818930 GTCCCCCAGCTGAAGTTGGGTGG + Intergenic
1191645271 X:63473174-63473196 GTCACCCAGCTGAAGTGCAATGG - Intergenic
1193233573 X:79077926-79077948 GCCAGCCAGGTGAAGTAGAAAGG + Intergenic
1193826729 X:86235427-86235449 ATGACCTAGGTGAAGATGGAAGG - Intronic