ID: 997043774

View in Genome Browser
Species Human (GRCh38)
Location 5:130289249-130289271
Sequence GCACTCTGGGGAATTACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997043774_997043780 4 Left 997043774 5:130289249-130289271 CCCCAGGTAATTCCCCAGAGTGC No data
Right 997043780 5:130289276-130289298 ATGTTGAAACCCCAAATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997043774 Original CRISPR GCACTCTGGGGAATTACCTG GGG (reversed) Intergenic
No off target data available for this crispr