ID: 997046563

View in Genome Browser
Species Human (GRCh38)
Location 5:130326108-130326130
Sequence TTCTGTCAAATCTACATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997046563_997046566 -5 Left 997046563 5:130326108-130326130 CCTAAAATGTAGATTTGACAGAA No data
Right 997046566 5:130326126-130326148 CAGAATAGAAAAGGGAGTGAAGG No data
997046563_997046568 4 Left 997046563 5:130326108-130326130 CCTAAAATGTAGATTTGACAGAA No data
Right 997046568 5:130326135-130326157 AAAGGGAGTGAAGGGAAGTATGG No data
997046563_997046567 -4 Left 997046563 5:130326108-130326130 CCTAAAATGTAGATTTGACAGAA No data
Right 997046567 5:130326127-130326149 AGAATAGAAAAGGGAGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997046563 Original CRISPR TTCTGTCAAATCTACATTTT AGG (reversed) Intergenic
No off target data available for this crispr