ID: 997050449

View in Genome Browser
Species Human (GRCh38)
Location 5:130373868-130373890
Sequence TTCAATATATGAATTTTAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997050449_997050455 9 Left 997050449 5:130373868-130373890 CCCGCTAAAATTCATATATTGAA No data
Right 997050455 5:130373900-130373922 CCAATAGTGATGGTATTAGGAGG No data
997050449_997050458 22 Left 997050449 5:130373868-130373890 CCCGCTAAAATTCATATATTGAA No data
Right 997050458 5:130373913-130373935 TATTAGGAGGTGAGGACTTTGGG No data
997050449_997050453 6 Left 997050449 5:130373868-130373890 CCCGCTAAAATTCATATATTGAA No data
Right 997050453 5:130373897-130373919 TCTCCAATAGTGATGGTATTAGG No data
997050449_997050457 21 Left 997050449 5:130373868-130373890 CCCGCTAAAATTCATATATTGAA No data
Right 997050457 5:130373912-130373934 GTATTAGGAGGTGAGGACTTTGG No data
997050449_997050451 -1 Left 997050449 5:130373868-130373890 CCCGCTAAAATTCATATATTGAA No data
Right 997050451 5:130373890-130373912 AACCTAATCTCCAATAGTGATGG No data
997050449_997050456 14 Left 997050449 5:130373868-130373890 CCCGCTAAAATTCATATATTGAA No data
Right 997050456 5:130373905-130373927 AGTGATGGTATTAGGAGGTGAGG 0: 38
1: 308
2: 1086
3: 2172
4: 2943
997050449_997050459 25 Left 997050449 5:130373868-130373890 CCCGCTAAAATTCATATATTGAA No data
Right 997050459 5:130373916-130373938 TAGGAGGTGAGGACTTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997050449 Original CRISPR TTCAATATATGAATTTTAGC GGG (reversed) Intergenic
No off target data available for this crispr