ID: 997050450

View in Genome Browser
Species Human (GRCh38)
Location 5:130373869-130373891
Sequence TTTCAATATATGAATTTTAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7447
Summary {0: 6, 1: 158, 2: 791, 3: 2255, 4: 4237}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997050450_997050457 20 Left 997050450 5:130373869-130373891 CCGCTAAAATTCATATATTGAAA 0: 6
1: 158
2: 791
3: 2255
4: 4237
Right 997050457 5:130373912-130373934 GTATTAGGAGGTGAGGACTTTGG No data
997050450_997050453 5 Left 997050450 5:130373869-130373891 CCGCTAAAATTCATATATTGAAA 0: 6
1: 158
2: 791
3: 2255
4: 4237
Right 997050453 5:130373897-130373919 TCTCCAATAGTGATGGTATTAGG No data
997050450_997050455 8 Left 997050450 5:130373869-130373891 CCGCTAAAATTCATATATTGAAA 0: 6
1: 158
2: 791
3: 2255
4: 4237
Right 997050455 5:130373900-130373922 CCAATAGTGATGGTATTAGGAGG No data
997050450_997050451 -2 Left 997050450 5:130373869-130373891 CCGCTAAAATTCATATATTGAAA 0: 6
1: 158
2: 791
3: 2255
4: 4237
Right 997050451 5:130373890-130373912 AACCTAATCTCCAATAGTGATGG No data
997050450_997050458 21 Left 997050450 5:130373869-130373891 CCGCTAAAATTCATATATTGAAA 0: 6
1: 158
2: 791
3: 2255
4: 4237
Right 997050458 5:130373913-130373935 TATTAGGAGGTGAGGACTTTGGG No data
997050450_997050459 24 Left 997050450 5:130373869-130373891 CCGCTAAAATTCATATATTGAAA 0: 6
1: 158
2: 791
3: 2255
4: 4237
Right 997050459 5:130373916-130373938 TAGGAGGTGAGGACTTTGGGAGG No data
997050450_997050456 13 Left 997050450 5:130373869-130373891 CCGCTAAAATTCATATATTGAAA 0: 6
1: 158
2: 791
3: 2255
4: 4237
Right 997050456 5:130373905-130373927 AGTGATGGTATTAGGAGGTGAGG 0: 38
1: 308
2: 1086
3: 2172
4: 2943

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997050450 Original CRISPR TTTCAATATATGAATTTTAG CGG (reversed) Intergenic
Too many off-targets to display for this crispr