ID: 997050453

View in Genome Browser
Species Human (GRCh38)
Location 5:130373897-130373919
Sequence TCTCCAATAGTGATGGTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997050450_997050453 5 Left 997050450 5:130373869-130373891 CCGCTAAAATTCATATATTGAAA 0: 6
1: 158
2: 791
3: 2255
4: 4237
Right 997050453 5:130373897-130373919 TCTCCAATAGTGATGGTATTAGG No data
997050449_997050453 6 Left 997050449 5:130373868-130373890 CCCGCTAAAATTCATATATTGAA No data
Right 997050453 5:130373897-130373919 TCTCCAATAGTGATGGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997050453 Original CRISPR TCTCCAATAGTGATGGTATT AGG Intergenic
No off target data available for this crispr