ID: 997052380

View in Genome Browser
Species Human (GRCh38)
Location 5:130398342-130398364
Sequence TCAGCCCCAGCTCAGCTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997052371_997052380 26 Left 997052371 5:130398293-130398315 CCCCTGCTCTATGCAGCCTTGGG 0: 15
1: 101
2: 216
3: 586
4: 1458
Right 997052380 5:130398342-130398364 TCAGCCCCAGCTCAGCTAAAAGG No data
997052374_997052380 24 Left 997052374 5:130398295-130398317 CCTGCTCTATGCAGCCTTGGGAC 0: 18
1: 62
2: 167
3: 389
4: 559
Right 997052380 5:130398342-130398364 TCAGCCCCAGCTCAGCTAAAAGG No data
997052376_997052380 10 Left 997052376 5:130398309-130398331 CCTTGGGACATGGTGCCCTGCAT 0: 30
1: 106
2: 507
3: 770
4: 1266
Right 997052380 5:130398342-130398364 TCAGCCCCAGCTCAGCTAAAAGG No data
997052369_997052380 27 Left 997052369 5:130398292-130398314 CCCCCTGCTCTATGCAGCCTTGG 0: 9
1: 64
2: 208
3: 549
4: 1357
Right 997052380 5:130398342-130398364 TCAGCCCCAGCTCAGCTAAAAGG No data
997052378_997052380 -6 Left 997052378 5:130398325-130398347 CCTGCATTCCAACTGCTTCAGCC No data
Right 997052380 5:130398342-130398364 TCAGCCCCAGCTCAGCTAAAAGG No data
997052377_997052380 -5 Left 997052377 5:130398324-130398346 CCCTGCATTCCAACTGCTTCAGC No data
Right 997052380 5:130398342-130398364 TCAGCCCCAGCTCAGCTAAAAGG No data
997052373_997052380 25 Left 997052373 5:130398294-130398316 CCCTGCTCTATGCAGCCTTGGGA 0: 18
1: 73
2: 197
3: 731
4: 988
Right 997052380 5:130398342-130398364 TCAGCCCCAGCTCAGCTAAAAGG No data
997052368_997052380 28 Left 997052368 5:130398291-130398313 CCCCCCTGCTCTATGCAGCCTTG 0: 10
1: 33
2: 138
3: 360
4: 891
Right 997052380 5:130398342-130398364 TCAGCCCCAGCTCAGCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997052380 Original CRISPR TCAGCCCCAGCTCAGCTAAA AGG Intergenic
No off target data available for this crispr