ID: 997055450

View in Genome Browser
Species Human (GRCh38)
Location 5:130438273-130438295
Sequence GTCTGGGTGTGAAGTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997055442_997055450 27 Left 997055442 5:130438223-130438245 CCTCATGTTGCTAGTCCATGTGA No data
Right 997055450 5:130438273-130438295 GTCTGGGTGTGAAGTGGAGAGGG No data
997055443_997055450 12 Left 997055443 5:130438238-130438260 CCATGTGAATGTGTGCTTCAAAT No data
Right 997055450 5:130438273-130438295 GTCTGGGTGTGAAGTGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997055450 Original CRISPR GTCTGGGTGTGAAGTGGAGA GGG Intergenic
No off target data available for this crispr