ID: 997060600

View in Genome Browser
Species Human (GRCh38)
Location 5:130497333-130497355
Sequence GAATAGGTAGGATGGGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997060594_997060600 1 Left 997060594 5:130497309-130497331 CCATTAAGTATGTGGGTGCAAAT No data
Right 997060600 5:130497333-130497355 GAATAGGTAGGATGGGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997060600 Original CRISPR GAATAGGTAGGATGGGAAAG TGG Intergenic
No off target data available for this crispr