ID: 997060660

View in Genome Browser
Species Human (GRCh38)
Location 5:130498529-130498551
Sequence CAGCTGAAGAATAATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997060660_997060664 27 Left 997060660 5:130498529-130498551 CCAACCTCATTATTCTTCAGCTG No data
Right 997060664 5:130498579-130498601 CTTTAACAAAGACCCTAATTGGG No data
997060660_997060663 26 Left 997060660 5:130498529-130498551 CCAACCTCATTATTCTTCAGCTG No data
Right 997060663 5:130498578-130498600 GCTTTAACAAAGACCCTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997060660 Original CRISPR CAGCTGAAGAATAATGAGGT TGG (reversed) Intergenic
No off target data available for this crispr