ID: 997065018

View in Genome Browser
Species Human (GRCh38)
Location 5:130549505-130549527
Sequence AACCCAAGACTGTTATTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997065018_997065020 3 Left 997065018 5:130549505-130549527 CCTCTAAATAACAGTCTTGGGTT No data
Right 997065020 5:130549531-130549553 CTAGGTCTCTGCAGAGATCCAGG No data
997065018_997065023 21 Left 997065018 5:130549505-130549527 CCTCTAAATAACAGTCTTGGGTT No data
Right 997065023 5:130549549-130549571 CCAGGATGCCTGAACAGAGTGGG No data
997065018_997065021 20 Left 997065018 5:130549505-130549527 CCTCTAAATAACAGTCTTGGGTT No data
Right 997065021 5:130549548-130549570 TCCAGGATGCCTGAACAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997065018 Original CRISPR AACCCAAGACTGTTATTTAG AGG (reversed) Intergenic
No off target data available for this crispr