ID: 997065382

View in Genome Browser
Species Human (GRCh38)
Location 5:130553630-130553652
Sequence TAGCCCTGCTTCAGAAAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997065380_997065382 -8 Left 997065380 5:130553615-130553637 CCACTACCTATGAGTTAGCCCTG No data
Right 997065382 5:130553630-130553652 TAGCCCTGCTTCAGAAAGAGCGG No data
997065379_997065382 -7 Left 997065379 5:130553614-130553636 CCCACTACCTATGAGTTAGCCCT No data
Right 997065382 5:130553630-130553652 TAGCCCTGCTTCAGAAAGAGCGG No data
997065376_997065382 22 Left 997065376 5:130553585-130553607 CCAAAAGACTACACATGGCTAAC No data
Right 997065382 5:130553630-130553652 TAGCCCTGCTTCAGAAAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997065382 Original CRISPR TAGCCCTGCTTCAGAAAGAG CGG Intergenic
No off target data available for this crispr