ID: 997065443

View in Genome Browser
Species Human (GRCh38)
Location 5:130554180-130554202
Sequence GTCAATGCAAATTGAGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997065443_997065452 9 Left 997065443 5:130554180-130554202 CCTACCCCTCAATTTGCATTGAC No data
Right 997065452 5:130554212-130554234 AATTTGCCTGTAAGTGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997065443 Original CRISPR GTCAATGCAAATTGAGGGGT AGG (reversed) Intergenic
No off target data available for this crispr