ID: 997065445

View in Genome Browser
Species Human (GRCh38)
Location 5:130554185-130554207
Sequence GGTGGGTCAATGCAAATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997065445_997065452 4 Left 997065445 5:130554185-130554207 CCCTCAATTTGCATTGACCCACC No data
Right 997065452 5:130554212-130554234 AATTTGCCTGTAAGTGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997065445 Original CRISPR GGTGGGTCAATGCAAATTGA GGG (reversed) Intergenic