ID: 997065452

View in Genome Browser
Species Human (GRCh38)
Location 5:130554212-130554234
Sequence AATTTGCCTGTAAGTGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997065446_997065452 3 Left 997065446 5:130554186-130554208 CCTCAATTTGCATTGACCCACCC No data
Right 997065452 5:130554212-130554234 AATTTGCCTGTAAGTGAAAGTGG No data
997065443_997065452 9 Left 997065443 5:130554180-130554202 CCTACCCCTCAATTTGCATTGAC No data
Right 997065452 5:130554212-130554234 AATTTGCCTGTAAGTGAAAGTGG No data
997065445_997065452 4 Left 997065445 5:130554185-130554207 CCCTCAATTTGCATTGACCCACC No data
Right 997065452 5:130554212-130554234 AATTTGCCTGTAAGTGAAAGTGG No data
997065442_997065452 28 Left 997065442 5:130554161-130554183 CCTAAAAAATTCTAAATAACCTA No data
Right 997065452 5:130554212-130554234 AATTTGCCTGTAAGTGAAAGTGG No data
997065444_997065452 5 Left 997065444 5:130554184-130554206 CCCCTCAATTTGCATTGACCCAC No data
Right 997065452 5:130554212-130554234 AATTTGCCTGTAAGTGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997065452 Original CRISPR AATTTGCCTGTAAGTGAAAG TGG Intergenic
No off target data available for this crispr