ID: 997066027

View in Genome Browser
Species Human (GRCh38)
Location 5:130559951-130559973
Sequence TTGTAAATAATTGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997066021_997066027 -5 Left 997066021 5:130559933-130559955 CCAATCCTACCAAAAGTATTGTA No data
Right 997066027 5:130559951-130559973 TTGTAAATAATTGAGGAGGAGGG No data
997066022_997066027 -10 Left 997066022 5:130559938-130559960 CCTACCAAAAGTATTGTAAATAA No data
Right 997066027 5:130559951-130559973 TTGTAAATAATTGAGGAGGAGGG No data
997066020_997066027 20 Left 997066020 5:130559908-130559930 CCAAATATATAAAGGAGAGCTTG No data
Right 997066027 5:130559951-130559973 TTGTAAATAATTGAGGAGGAGGG No data
997066018_997066027 30 Left 997066018 5:130559898-130559920 CCAAATTTTACCAAATATATAAA No data
Right 997066027 5:130559951-130559973 TTGTAAATAATTGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997066027 Original CRISPR TTGTAAATAATTGAGGAGGA GGG Intergenic
No off target data available for this crispr