ID: 997071254

View in Genome Browser
Species Human (GRCh38)
Location 5:130625103-130625125
Sequence CCTTCTGTATTCAAGGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997071254_997071260 2 Left 997071254 5:130625103-130625125 CCTTGAACCTTGAATACAGAAGG No data
Right 997071260 5:130625128-130625150 GAATGTAAGCAACTCAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997071254 Original CRISPR CCTTCTGTATTCAAGGTTCA AGG (reversed) Intergenic
No off target data available for this crispr