ID: 997086888

View in Genome Browser
Species Human (GRCh38)
Location 5:130811190-130811212
Sequence CATTTATACCTTCTAAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997086888_997086891 18 Left 997086888 5:130811190-130811212 CCCTTCTTTAGAAGGTATAAATG No data
Right 997086891 5:130811231-130811253 CTTTGAAGAAGGAGTTTCCATGG No data
997086888_997086890 7 Left 997086888 5:130811190-130811212 CCCTTCTTTAGAAGGTATAAATG No data
Right 997086890 5:130811220-130811242 TTTCAACATTTCTTTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997086888 Original CRISPR CATTTATACCTTCTAAAGAA GGG (reversed) Intergenic
No off target data available for this crispr