ID: 997086891 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:130811231-130811253 |
Sequence | CTTTGAAGAAGGAGTTTCCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
997086889_997086891 | 17 | Left | 997086889 | 5:130811191-130811213 | CCTTCTTTAGAAGGTATAAATGA | No data | ||
Right | 997086891 | 5:130811231-130811253 | CTTTGAAGAAGGAGTTTCCATGG | No data | ||||
997086888_997086891 | 18 | Left | 997086888 | 5:130811190-130811212 | CCCTTCTTTAGAAGGTATAAATG | No data | ||
Right | 997086891 | 5:130811231-130811253 | CTTTGAAGAAGGAGTTTCCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
997086891 | Original CRISPR | CTTTGAAGAAGGAGTTTCCA TGG | Intergenic | ||
No off target data available for this crispr |