ID: 997086891

View in Genome Browser
Species Human (GRCh38)
Location 5:130811231-130811253
Sequence CTTTGAAGAAGGAGTTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997086889_997086891 17 Left 997086889 5:130811191-130811213 CCTTCTTTAGAAGGTATAAATGA No data
Right 997086891 5:130811231-130811253 CTTTGAAGAAGGAGTTTCCATGG No data
997086888_997086891 18 Left 997086888 5:130811190-130811212 CCCTTCTTTAGAAGGTATAAATG No data
Right 997086891 5:130811231-130811253 CTTTGAAGAAGGAGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997086891 Original CRISPR CTTTGAAGAAGGAGTTTCCA TGG Intergenic
No off target data available for this crispr