ID: 997089303

View in Genome Browser
Species Human (GRCh38)
Location 5:130838440-130838462
Sequence CCTTCATTAGACATTGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997089303_997089309 30 Left 997089303 5:130838440-130838462 CCAGAATCAATGTCTAATGAAGG No data
Right 997089309 5:130838493-130838515 CTGAATCCTCAAATGGTGGAAGG No data
997089303_997089308 26 Left 997089303 5:130838440-130838462 CCAGAATCAATGTCTAATGAAGG No data
Right 997089308 5:130838489-130838511 CTCACTGAATCCTCAAATGGTGG No data
997089303_997089305 -3 Left 997089303 5:130838440-130838462 CCAGAATCAATGTCTAATGAAGG No data
Right 997089305 5:130838460-130838482 AGGTTTACTTTCTCCTTCATAGG No data
997089303_997089307 23 Left 997089303 5:130838440-130838462 CCAGAATCAATGTCTAATGAAGG No data
Right 997089307 5:130838486-130838508 CATCTCACTGAATCCTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997089303 Original CRISPR CCTTCATTAGACATTGATTC TGG (reversed) Intergenic
No off target data available for this crispr