ID: 997089306

View in Genome Browser
Species Human (GRCh38)
Location 5:130838473-130838495
Sequence CAGTGAGATGTATCCTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997089306_997089308 -7 Left 997089306 5:130838473-130838495 CCTTCATAGGATACATCTCACTG No data
Right 997089308 5:130838489-130838511 CTCACTGAATCCTCAAATGGTGG No data
997089306_997089313 15 Left 997089306 5:130838473-130838495 CCTTCATAGGATACATCTCACTG No data
Right 997089313 5:130838511-130838533 GAAGGGGCTAGCTATCTCTCTGG No data
997089306_997089309 -3 Left 997089306 5:130838473-130838495 CCTTCATAGGATACATCTCACTG No data
Right 997089309 5:130838493-130838515 CTGAATCCTCAAATGGTGGAAGG No data
997089306_997089307 -10 Left 997089306 5:130838473-130838495 CCTTCATAGGATACATCTCACTG No data
Right 997089307 5:130838486-130838508 CATCTCACTGAATCCTCAAATGG No data
997089306_997089315 17 Left 997089306 5:130838473-130838495 CCTTCATAGGATACATCTCACTG No data
Right 997089315 5:130838513-130838535 AGGGGCTAGCTATCTCTCTGGGG No data
997089306_997089314 16 Left 997089306 5:130838473-130838495 CCTTCATAGGATACATCTCACTG No data
Right 997089314 5:130838512-130838534 AAGGGGCTAGCTATCTCTCTGGG No data
997089306_997089311 -1 Left 997089306 5:130838473-130838495 CCTTCATAGGATACATCTCACTG No data
Right 997089311 5:130838495-130838517 GAATCCTCAAATGGTGGAAGGGG No data
997089306_997089310 -2 Left 997089306 5:130838473-130838495 CCTTCATAGGATACATCTCACTG No data
Right 997089310 5:130838494-130838516 TGAATCCTCAAATGGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997089306 Original CRISPR CAGTGAGATGTATCCTATGA AGG (reversed) Intergenic
No off target data available for this crispr