ID: 997089309

View in Genome Browser
Species Human (GRCh38)
Location 5:130838493-130838515
Sequence CTGAATCCTCAAATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997089303_997089309 30 Left 997089303 5:130838440-130838462 CCAGAATCAATGTCTAATGAAGG No data
Right 997089309 5:130838493-130838515 CTGAATCCTCAAATGGTGGAAGG No data
997089306_997089309 -3 Left 997089306 5:130838473-130838495 CCTTCATAGGATACATCTCACTG No data
Right 997089309 5:130838493-130838515 CTGAATCCTCAAATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997089309 Original CRISPR CTGAATCCTCAAATGGTGGA AGG Intergenic
No off target data available for this crispr