ID: 997090488

View in Genome Browser
Species Human (GRCh38)
Location 5:130850775-130850797
Sequence GTGGAGCCATAGGCTACACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997090488_997090495 30 Left 997090488 5:130850775-130850797 CCTAGTGTAGCCTATGGCTCCAC No data
Right 997090495 5:130850828-130850850 GGATCATAATTCCAAGCAAAAGG No data
997090488_997090493 9 Left 997090488 5:130850775-130850797 CCTAGTGTAGCCTATGGCTCCAC No data
Right 997090493 5:130850807-130850829 GGGAAATATCCTGATAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997090488 Original CRISPR GTGGAGCCATAGGCTACACT AGG (reversed) Intergenic
No off target data available for this crispr