ID: 997097512

View in Genome Browser
Species Human (GRCh38)
Location 5:130929708-130929730
Sequence TCACCTAGTTGGGTGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997097512_997097524 28 Left 997097512 5:130929708-130929730 CCCTGTGCCACCCAACTAGGTGA No data
Right 997097524 5:130929759-130929781 CTATAGAGGAGTGATCCTACTGG No data
997097512_997097521 14 Left 997097512 5:130929708-130929730 CCCTGTGCCACCCAACTAGGTGA No data
Right 997097521 5:130929745-130929767 AGTTGTCAGACTCCCTATAGAGG No data
997097512_997097517 -9 Left 997097512 5:130929708-130929730 CCCTGTGCCACCCAACTAGGTGA No data
Right 997097517 5:130929722-130929744 ACTAGGTGAGACCCTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997097512 Original CRISPR TCACCTAGTTGGGTGGCACA GGG (reversed) Intergenic