ID: 997098819

View in Genome Browser
Species Human (GRCh38)
Location 5:130945199-130945221
Sequence CTCTGAAAGAAAATGTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997098815_997098819 7 Left 997098815 5:130945169-130945191 CCTTAAGTAGCTGCTGCATATTT No data
Right 997098819 5:130945199-130945221 CTCTGAAAGAAAATGTATCTAGG No data
997098814_997098819 21 Left 997098814 5:130945155-130945177 CCAGGACAACAGGGCCTTAAGTA No data
Right 997098819 5:130945199-130945221 CTCTGAAAGAAAATGTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997098819 Original CRISPR CTCTGAAAGAAAATGTATCT AGG Intergenic
No off target data available for this crispr