ID: 997099823

View in Genome Browser
Species Human (GRCh38)
Location 5:130956956-130956978
Sequence CTGACTAGCCATATGCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997099823_997099828 5 Left 997099823 5:130956956-130956978 CCAGTCTGCATATGGCTAGTCAG No data
Right 997099828 5:130956984-130957006 CCAGCACCATTGGTTAAATAGGG 0: 7
1: 680
2: 13206
3: 8093
4: 5163
997099823_997099826 4 Left 997099823 5:130956956-130956978 CCAGTCTGCATATGGCTAGTCAG No data
Right 997099826 5:130956983-130957005 CCCAGCACCATTGGTTAAATAGG 0: 7
1: 664
2: 13076
3: 8239
4: 5851
997099823_997099824 -5 Left 997099823 5:130956956-130956978 CCAGTCTGCATATGGCTAGTCAG No data
Right 997099824 5:130956974-130956996 GTCAGTTATCCCAGCACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997099823 Original CRISPR CTGACTAGCCATATGCAGAC TGG (reversed) Intergenic
No off target data available for this crispr