ID: 997114437

View in Genome Browser
Species Human (GRCh38)
Location 5:131111441-131111463
Sequence GCCATGAGCACAGTCAGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997114437_997114440 14 Left 997114437 5:131111441-131111463 CCCAAACTGACTGTGCTCATGGC No data
Right 997114440 5:131111478-131111500 ACCAGGAATGAACAAATAAAAGG No data
997114437_997114442 20 Left 997114437 5:131111441-131111463 CCCAAACTGACTGTGCTCATGGC No data
Right 997114442 5:131111484-131111506 AATGAACAAATAAAAGGACTAGG No data
997114437_997114439 -3 Left 997114437 5:131111441-131111463 CCCAAACTGACTGTGCTCATGGC No data
Right 997114439 5:131111461-131111483 GGCAGTTTACAACTACTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997114437 Original CRISPR GCCATGAGCACAGTCAGTTT GGG (reversed) Intergenic
No off target data available for this crispr