ID: 997119173

View in Genome Browser
Species Human (GRCh38)
Location 5:131156634-131156656
Sequence TTGGGTTCCCACATGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997119169_997119173 3 Left 997119169 5:131156608-131156630 CCTGGTTTGTAAGGACTTTATTC No data
Right 997119173 5:131156634-131156656 TTGGGTTCCCACATGGTGAAAGG No data
997119168_997119173 9 Left 997119168 5:131156602-131156624 CCACTTCCTGGTTTGTAAGGACT No data
Right 997119173 5:131156634-131156656 TTGGGTTCCCACATGGTGAAAGG No data
997119167_997119173 10 Left 997119167 5:131156601-131156623 CCCACTTCCTGGTTTGTAAGGAC No data
Right 997119173 5:131156634-131156656 TTGGGTTCCCACATGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997119173 Original CRISPR TTGGGTTCCCACATGGTGAA AGG Intergenic
No off target data available for this crispr