ID: 997121419

View in Genome Browser
Species Human (GRCh38)
Location 5:131176964-131176986
Sequence AGGTGCTAGTAGAACTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997121419 Original CRISPR AGGTGCTAGTAGAACTGTGA GGG (reversed) Intronic
900524853 1:3123595-3123617 AGGTGCTGCTGGAACTGGGAGGG + Intronic
901012513 1:6209663-6209685 AGTTGCTAGGAGAGCTGGGAGGG + Intronic
908140509 1:61179578-61179600 AGGTGCTAGCAGAGCTTTGAGGG + Intronic
908892053 1:68859643-68859665 AGGGGATAAAAGAACTGTGAAGG - Intergenic
916051579 1:161040154-161040176 AGTGGCTAGCAGAACTGAGAAGG + Intronic
918866592 1:189907829-189907851 AGGTGCTAGAAAATCTGAGATGG - Intergenic
919702374 1:200643908-200643930 ATGTGCTTGTGGAACTGTGGGGG + Intronic
920092371 1:203463813-203463835 AGGTGCCTGTAGCTCTGTGAGGG + Intergenic
920932356 1:210400752-210400774 AGATGATTGTAGAACTGTGATGG + Intronic
1066315018 10:34236765-34236787 TGGTGCTAAGAGAATTGTGAAGG - Intronic
1068015538 10:51512121-51512143 GGGTGGTGGTAGGACTGTGAGGG + Intronic
1068281006 10:54869809-54869831 ATGTGCTAGTGGTTCTGTGAAGG - Intronic
1068481191 10:57590804-57590826 AAGAGCTAGTAGAACAGTGGAGG - Intergenic
1075478722 10:122760316-122760338 AGATGCCAGTAGAAATCTGAAGG + Intergenic
1076749471 10:132535455-132535477 AGGAGGCAGGAGAACTGTGAGGG + Intergenic
1078443411 11:11386057-11386079 AGGTGCCAGCAGGACTATGAGGG - Intronic
1082866024 11:57900851-57900873 TGGTGCTAGGAGAAGTGTGGGGG + Intergenic
1083480907 11:62946100-62946122 AGGTGCTAGGAAAAGTTTGAAGG + Intronic
1085299385 11:75449498-75449520 ACCTGTGAGTAGAACTGTGAAGG - Exonic
1086074232 11:82833278-82833300 AGGTGCTAGTAGAAGTAAGGGGG + Intronic
1091644498 12:2263532-2263554 CGGTGTTGGTAGAAGTGTGACGG + Intronic
1096095305 12:48931358-48931380 AGGTGGTAGTAGAAATGGAAAGG + Intronic
1100025674 12:90124986-90125008 AGATGCTAGAGAAACTGTGAAGG + Intergenic
1110494179 13:76146820-76146842 AGTTGACAGTAGAACTGTGCTGG - Intergenic
1114179092 14:20350075-20350097 AGCTGTGAGTAGAACTGTCAAGG + Intronic
1115963400 14:38861702-38861724 ACGAGCTAGTACAATTGTGATGG + Intergenic
1116400018 14:44495275-44495297 TTGTGCTAATAGAAGTGTGAGGG - Intergenic
1119428001 14:74548265-74548287 AGGTGCTACTGGACCTATGAGGG + Intronic
1120210980 14:81633481-81633503 AGGTGATAGTAGTAATGAGAAGG + Intergenic
1121472261 14:94165005-94165027 GGGTGCCTGTAGAACCGTGATGG - Intronic
1126922534 15:53543843-53543865 AGGTGTTTGTAGTACTCTGATGG - Intronic
1128675054 15:69602492-69602514 AGGTGCTAAGAGACCTCTGAAGG + Intergenic
1129024753 15:72560277-72560299 AGGTGCCATGAGAACTGAGAGGG + Intronic
1134073006 16:11272279-11272301 TGGTGCTTGGAGGACTGTGAGGG + Intronic
1139350086 16:66329452-66329474 AGGTGCTACCAGAACTGAGCAGG + Intergenic
1141417606 16:83888540-83888562 AGGTGGTAGTAAAAATGTCAGGG + Intergenic
1147338842 17:39742171-39742193 AGGTGCTAGGTAAACTCTGAGGG + Intronic
1155936722 18:31762400-31762422 AGGTGCCTTTAGAAATGTGAAGG - Intergenic
934026432 2:88005342-88005364 AGGTGCTGGAAGACCAGTGAAGG - Intergenic
936670514 2:114651017-114651039 AGGTGGTAGTCAAACTATGAAGG - Intronic
939833115 2:147096258-147096280 ATGTGATAGATGAACTGTGATGG - Intergenic
1170906048 20:20515990-20516012 TGCTGCTAGTAGAACACTGAGGG + Intronic
1174613073 20:51815011-51815033 AGGTTTTAGGAGAACTCTGAGGG + Intergenic
1175380157 20:58557328-58557350 AGAAGCTAGGAGAACGGTGAGGG + Intergenic
1179068254 21:38046793-38046815 AGGTTCTATAAGAAGTGTGATGG + Intronic
1180692740 22:17731010-17731032 AACAGCTATTAGAACTGTGAAGG - Intergenic
1184330317 22:43823105-43823127 AGGTGCTGTGAGGACTGTGAGGG - Intergenic
1184826289 22:46953970-46953992 AGGAGGTAGCAGAGCTGTGATGG + Intronic
949356365 3:3184220-3184242 AGGTGCTTGCAGCACTGTGATGG + Intergenic
952093754 3:29923305-29923327 ATGTGCTAGTTTATCTGTGATGG - Intronic
953760134 3:45680179-45680201 ATGTGAAAGTAGAGCTGTGATGG + Exonic
959472123 3:106764727-106764749 AGGTGCTTGAAGAAATGTTAAGG - Intergenic
959510186 3:107202057-107202079 AGGTGCTTTGACAACTGTGAAGG - Intergenic
962265163 3:133939517-133939539 GTTTGCTAGCAGAACTGTGATGG - Intronic
964233405 3:154496624-154496646 AGGTCCTAGTAAAGCTGTGGGGG + Intergenic
968984344 4:3867042-3867064 AGGTGCCAGCAGGACTGTGGTGG + Intergenic
971513002 4:27450562-27450584 AGTTGGTAGTAGAAAGGTGAGGG - Intergenic
977525158 4:98136265-98136287 AGGTGCTCCTTGACCTGTGATGG + Intronic
977745520 4:100542321-100542343 AGGTAGTAGTAAAACTGAGAAGG + Intronic
979305176 4:119134184-119134206 AGGTGCTAGTAAAACTGTTGAGG + Intergenic
981517687 4:145627706-145627728 AGGTGCTATTTGAACTGAGTAGG + Intronic
984540932 4:181036000-181036022 AGGTGCTCCTGGAACTGTCATGG + Intergenic
987562691 5:19544498-19544520 AGGGTTTAGTTGAACTGTGATGG - Intronic
988403271 5:30790810-30790832 AGATACTAGCAGAAATGTGATGG + Intergenic
989110765 5:37904852-37904874 AGGAGCTGGTAGACTTGTGAAGG + Intergenic
992741052 5:79774093-79774115 AGGTGCTAGTTGAACTTTTATGG + Intronic
995176942 5:109189012-109189034 AGGTGGAAGTAGAAATGGGAGGG - Exonic
997121419 5:131176964-131176986 AGGTGCTAGTAGAACTGTGAGGG - Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998374930 5:141683988-141684010 TGGAGCTAGGAGAGCTGTGAAGG - Intergenic
1001611603 5:173007345-173007367 ATGTGCTTATAGAACTGAGATGG + Intronic
1006855316 6:37129032-37129054 AGGTGCTAATGAGACTGTGAGGG - Intergenic
1006902677 6:37513179-37513201 GGGTGCTGGTAGCACCGTGATGG - Intergenic
1012091968 6:94909704-94909726 TGGTGATAGTTGAATTGTGATGG - Intergenic
1013834463 6:114317426-114317448 AGGTGCTAACTGAAATGTGAAGG + Intronic
1019347843 7:539343-539365 AGGGGCCAGTAGAACCGGGAGGG + Intergenic
1027706837 7:81545425-81545447 AATTTCTACTAGAACTGTGATGG + Intergenic
1027870138 7:83696222-83696244 AAGTGCTATTAGTACAGTGAGGG + Intergenic
1029412231 7:100421277-100421299 AGGTGGTAGTAGAGCAGTGATGG + Intronic
1030269860 7:107659914-107659936 AGGAGCTCGTAGAATTGTCATGG + Intergenic
1040447597 8:47511473-47511495 AGGTGCCAGCAGAGCTGTGGAGG - Intronic
1045089608 8:98727765-98727787 AGGTGCTAGTAGGAAAATGAAGG - Intronic
1045161610 8:99553357-99553379 AGGTGATACTAGAAATGTTAAGG + Intronic
1045982979 8:108213755-108213777 AAGTGCTAATAAAACTGTGAAGG + Intronic
1056772584 9:89490714-89490736 AGTTGCTCCTAGACCTGTGATGG - Intronic
1056799200 9:89679799-89679821 AGCTCCTAGTACATCTGTGATGG + Intergenic
1203370351 Un_KI270442v1:297900-297922 ATGGCCTAGTAGATCTGTGAGGG - Intergenic
1187105760 X:16239772-16239794 AGGAGCTGGTAGAGCTGTCATGG + Intergenic
1188791447 X:34412437-34412459 AGGTGTTTGTAGAACTCAGACGG - Intergenic
1191897305 X:66006581-66006603 AAGTGATAATACAACTGTGAGGG - Intergenic
1193397482 X:81003190-81003212 AGGAGCTAGAAGACCTGAGAAGG - Intergenic
1195760185 X:108237325-108237347 AGGTGGGAGTTGAACGGTGAAGG - Intronic
1195842329 X:109187851-109187873 AGGTGGTAGTAGTAGTGTGTAGG - Intergenic
1198611819 X:138410472-138410494 AGAAGATAGGAGAACTGTGAAGG + Intergenic