ID: 997121872

View in Genome Browser
Species Human (GRCh38)
Location 5:131182806-131182828
Sequence AACTTCTACTAGGAGTATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997121872_997121875 27 Left 997121872 5:131182806-131182828 CCCTAATACTCCTAGTAGAAGTT 0: 1
1: 0
2: 0
3: 5
4: 94
Right 997121875 5:131182856-131182878 TTCCTATATATTATGTATTCTGG 0: 1
1: 0
2: 1
3: 40
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997121872 Original CRISPR AACTTCTACTAGGAGTATTA GGG (reversed) Intronic
904204622 1:28845679-28845701 ATTTTCTTCTAGGAGTTTTATGG + Intronic
906022638 1:42644057-42644079 AACTTTTACTTGGTGTATTAGGG + Intronic
906955123 1:50367797-50367819 ATCTTCTTCTAGCTGTATTAAGG - Intergenic
907665931 1:56433889-56433911 AACTTCATTTAGGAGTATCAAGG + Intergenic
909734095 1:78934439-78934461 ATTTTCTTCTAGGAGTTTTATGG - Intronic
911126053 1:94341975-94341997 AACTTTTACTGGGAGTATAACGG - Intergenic
913019564 1:114775014-114775036 ATTTTCTACTTGAAGTATTAAGG + Intronic
916585472 1:166146080-166146102 AACTTCTACTACCTGTATGAAGG + Intronic
916871899 1:168924212-168924234 AACTTCTACTAGTATTTTTGTGG - Intergenic
1064024800 10:11839264-11839286 AATTTCTACTAGCATTTTTATGG - Intronic
1066748602 10:38629368-38629390 ATTTTCTACTAGTAGTTTTATGG - Intergenic
1067811543 10:49430870-49430892 AATTTCTACTCGCAGTAATAAGG - Intergenic
1069348245 10:67495393-67495415 AAATGCTTCTAGGAGTCTTAGGG - Intronic
1075843426 10:125524502-125524524 ATTTTCTTCTAGGAGTTTTAAGG + Intergenic
1079563530 11:21852153-21852175 GTTTTCTACTAGGAGTTTTATGG - Intergenic
1079865248 11:25725797-25725819 AAATTCTACTAGATGTATAATGG - Intergenic
1086546644 11:87975417-87975439 AACTTGTACTACGAGAAATAAGG + Intergenic
1088308830 11:108438591-108438613 ATTTTCTTCTAGGAGTTTTATGG - Intronic
1091026867 11:132149296-132149318 AGCTTCTGCTAGGGGAATTAGGG - Intronic
1091989147 12:4940700-4940722 AACTTCTTCTAGGAGCACAAAGG + Intergenic
1093360069 12:18214299-18214321 ATTTTCTTCTAGGAGTTTTATGG - Intronic
1094244029 12:28266449-28266471 AGCTTTTACTAGGTGAATTATGG + Intronic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1097814218 12:64054558-64054580 AACTCCTATTAGGAAGATTATGG + Intronic
1099147173 12:79061149-79061171 AACTTCTAATCAGCGTATTATGG + Intronic
1099297372 12:80845447-80845469 AAATGTTACTTGGAGTATTATGG + Intronic
1101758297 12:107638650-107638672 AACCTCTACTAATAGTATAATGG + Intronic
1109902993 13:68797944-68797966 CAATGCTACTAGGATTATTATGG + Intergenic
1110162125 13:72390974-72390996 AACTTCTGCTAGGTAGATTAAGG + Intergenic
1114519418 14:23323714-23323736 AGCTTCTACTTGGCCTATTATGG + Intronic
1117921513 14:60729547-60729569 AACTTGTACTGGAAGAATTAAGG + Intergenic
1120734072 14:88034002-88034024 AACTTGTATTAGGAATATTTGGG - Intergenic
1125247415 15:37657119-37657141 GTCTTCTTCTAGGAGTTTTATGG - Intergenic
1131588214 15:93718951-93718973 CATTTCTACTGGGCGTATTAGGG - Intergenic
1137955216 16:52822706-52822728 AACTGCTTCTAGGAATATCAAGG + Intergenic
1147199633 17:38791733-38791755 TACTTCTACTCAGTGTATTAAGG + Intronic
1148794519 17:50190636-50190658 GTCATCTACTAGGAGTATTCAGG - Intronic
1150174067 17:63031824-63031846 ACCTTCTACATGGAGTACTAAGG + Intronic
1151062698 17:71114462-71114484 AATTTATCCCAGGAGTATTATGG + Intergenic
1152896876 17:82916742-82916764 AACTTGTTCTAGGAATATCACGG - Intronic
1155638746 18:27986720-27986742 AACTTCTATGAGGAATATGATGG + Intronic
1159398642 18:67900298-67900320 ATTTTCTCCTAGGAGTTTTACGG - Intergenic
1165584948 19:36906521-36906543 CAGTTCTACTAGCAGTATGAAGG - Intronic
926100100 2:10110090-10110112 AATTTCTACTAAGACTAATAAGG + Intergenic
926995856 2:18735193-18735215 ATTTTCTTCTAGGAGTTTTATGG - Intergenic
927386354 2:22538578-22538600 AATTTCTACTCAGAGTATAATGG - Intergenic
927668504 2:25049107-25049129 AACTGCTAGTAGGAGTATAATGG - Intronic
929714861 2:44299468-44299490 ATCTCCTGCTAGGAGTAATATGG - Intronic
930921219 2:56756374-56756396 AATTTCTACAGGGAGTATGATGG + Intergenic
931585326 2:63820051-63820073 AACTTCTTCTGTGAGAATTAAGG + Intronic
935043256 2:99454761-99454783 AACTAATAGTAGGAGTATTGTGG - Intronic
938632365 2:133180732-133180754 ATTTTCTTCTAGGAGTGTTATGG - Intronic
939389833 2:141552785-141552807 AAATTCTACTGGGATTATTGGGG + Intronic
940482567 2:154253662-154253684 ATCATCTAATAGGAGTTTTAGGG - Intronic
943042779 2:182823120-182823142 AAGTTCTATTAGGAATATTTAGG - Intergenic
1168785635 20:537600-537622 AAATTCCTCTAGGATTATTAAGG - Intronic
1169153010 20:3305311-3305333 AGCTTCACCTAGGAGTCTTATGG - Intronic
1169904487 20:10587880-10587902 TTCTTCTACTAGAAGTTTTATGG - Intronic
1178427312 21:32489196-32489218 GATTTCTTCTAGGAGTTTTATGG + Intronic
951643210 3:24859073-24859095 AGCTTCTAATAAGAGTATTAAGG - Intergenic
953382382 3:42482115-42482137 ATCTTCTAAGAGGAGTATTTAGG - Intergenic
956350692 3:68332301-68332323 ATTTTCTCCTAGGAGTTTTATGG - Intronic
958552920 3:95639479-95639501 AACTTTTGCAAGCAGTATTATGG - Intergenic
970885479 4:20983713-20983735 AACTTTTACTTTGAGTATTAAGG + Intronic
970989609 4:22197181-22197203 AACCACTACTAGGAAAATTAAGG + Intergenic
971985687 4:33820415-33820437 AACTTCTATTAGGATTCATAAGG - Intergenic
973105584 4:46332311-46332333 AACATTTTCTAGGAGGATTAAGG - Intronic
982807553 4:159785525-159785547 ATTTTCTCCTAGGAGTTTTATGG - Intergenic
985433798 4:189907798-189907820 GTCTTCTTCTAGGAGTTTTATGG + Intergenic
988206928 5:28149702-28149724 ATCTTCTACTTGGAGAACTATGG - Intergenic
990091785 5:52060381-52060403 AAATTATACTAGTAATATTATGG + Intronic
995210911 5:109537732-109537754 AACTTCTACTAAGACTAACAAGG + Intergenic
995243486 5:109911791-109911813 AACTTCTCCAAGGAGTCCTAGGG - Intergenic
995812016 5:116117964-116117986 AACTTCTACAATGAGTAACATGG - Intronic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
998576033 5:143317679-143317701 AATTGCTACAAGGAGGATTATGG + Intronic
1006197874 6:32258201-32258223 ATTTTCTTCTAGGAGTTTTATGG + Intergenic
1011741681 6:90367596-90367618 ACTTTCTTCTAGGAGTTTTATGG + Intergenic
1018444915 6:163847197-163847219 ATTTTCTCCTAGGAGTTTTATGG + Intergenic
1021160417 7:17265614-17265636 ATTTTCTTCTAGGAGTTTTATGG + Intergenic
1021525584 7:21583469-21583491 GATTTCTTCTAGGGGTATTATGG - Intronic
1025863575 7:65358460-65358482 AACTTCCATTAGGATTGTTAGGG - Intergenic
1030101892 7:105954108-105954130 AACTTCTTTGAGGAGTATTTTGG + Intronic
1032403307 7:131638491-131638513 AGCGTCTACTAGGTGGATTAGGG + Intergenic
1038089258 8:24235489-24235511 AACTACTACTAGTACTAGTAAGG + Intergenic
1044568583 8:93692792-93692814 AACTTCTACTAAGTGTAATGTGG - Intergenic
1048650417 8:136469928-136469950 AACGTCTGCAAGGAGAATTAAGG - Intergenic
1052334514 9:27306051-27306073 AACTTCTAAGAGGAGGGTTATGG + Intergenic
1055764755 9:79650432-79650454 AACATACACAAGGAGTATTAGGG + Intronic
1057511426 9:95682662-95682684 GATTTCTTCTAGGAGTTTTATGG - Intergenic
1060119702 9:120976962-120976984 TAATTCTACCAGGTGTATTATGG + Intronic
1060702419 9:125768368-125768390 AACTTATTTTAGGAGTATAAAGG - Intronic
1186433702 X:9525866-9525888 CACTCCTAATAGTAGTATTAGGG - Intronic
1186826444 X:13344891-13344913 GTTTTCTTCTAGGAGTATTACGG - Intergenic
1187258608 X:17664295-17664317 ATTTTCTTCTAGGAGTTTTATGG + Intronic
1192378167 X:70586209-70586231 AAATTCTTCTAAGAGTTTTATGG - Intronic
1194850872 X:98866762-98866784 ACATTCTACTAGGTGTATCATGG + Intergenic
1195852918 X:109302733-109302755 AAGTTCTTCTAGGGGTATTTAGG + Intergenic
1196496368 X:116328932-116328954 AAGTTCTACTGGGAGTAGGATGG - Intergenic
1196646272 X:118120538-118120560 AACTTTTACAAAGAGCATTAGGG + Intergenic