ID: 997121875

View in Genome Browser
Species Human (GRCh38)
Location 5:131182856-131182878
Sequence TTCCTATATATTATGTATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997121873_997121875 26 Left 997121873 5:131182807-131182829 CCTAATACTCCTAGTAGAAGTTT 0: 1
1: 0
2: 1
3: 6
4: 131
Right 997121875 5:131182856-131182878 TTCCTATATATTATGTATTCTGG 0: 1
1: 0
2: 1
3: 40
4: 246
997121874_997121875 17 Left 997121874 5:131182816-131182838 CCTAGTAGAAGTTTATTGAAAAA 0: 1
1: 0
2: 0
3: 53
4: 486
Right 997121875 5:131182856-131182878 TTCCTATATATTATGTATTCTGG 0: 1
1: 0
2: 1
3: 40
4: 246
997121872_997121875 27 Left 997121872 5:131182806-131182828 CCCTAATACTCCTAGTAGAAGTT 0: 1
1: 0
2: 0
3: 5
4: 94
Right 997121875 5:131182856-131182878 TTCCTATATATTATGTATTCTGG 0: 1
1: 0
2: 1
3: 40
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997121875 Original CRISPR TTCCTATATATTATGTATTC TGG Intronic
906514508 1:46431138-46431160 TTACTAAATCTTATGGATTCGGG - Intergenic
906615633 1:47231256-47231278 TTCCAAATTATGATGTATTCGGG - Intronic
908492438 1:64659608-64659630 TTGCTATATTTTATGTTATCTGG - Intronic
908905414 1:69003280-69003302 TTCCTCTATATTAAGTCTTAAGG + Intergenic
909415271 1:75399280-75399302 TACCTAGCTAGTATGTATTCTGG + Intronic
909505534 1:76385297-76385319 TTCTTATCTATTATTTATTATGG + Intronic
912026585 1:105182652-105182674 TTCTTTTATACTATGTATACAGG + Intergenic
913304835 1:117417260-117417282 TGCATATATAGTATGTATTTGGG + Intronic
916415452 1:164588540-164588562 TGCATATATATTCTTTATTCTGG + Intronic
916972818 1:170042696-170042718 TTCCTTTATACTATATACTCTGG + Intronic
918029805 1:180795595-180795617 TTTCTATTTATTAAGTAGTCAGG - Intronic
918259066 1:182777642-182777664 TTCTTATATACTGTGTATTAAGG + Intergenic
918598032 1:186316308-186316330 TTTCTATACATTATGTAATATGG - Intronic
918926628 1:190794421-190794443 CTCATATATATAATGTATTAAGG + Intergenic
919292691 1:195653365-195653387 TTCCTAAATATTTTATATACTGG - Intergenic
921577212 1:216849658-216849680 TTCCTATATAATCTGTATCAAGG - Intronic
921782300 1:219179621-219179643 TTCCCAGAGATTATGAATTCTGG - Intronic
1065399304 10:25278369-25278391 TTCCTCTATATTTTGCATTCTGG - Intronic
1065450400 10:25850469-25850491 TTCCTATGGATTTTGCATTCAGG - Intergenic
1068282535 10:54893721-54893743 TTATTATATTTTATGTAATCTGG - Intronic
1068959457 10:62852017-62852039 TTCCTATATGACATGTCTTCAGG + Intronic
1069147482 10:64913159-64913181 TCTCTATATATTCTGGATTCAGG + Intergenic
1070065575 10:73030445-73030467 GTCCTATATATTAAATATTATGG - Intronic
1071379196 10:85040777-85040799 TTCCTATAGAATATATATGCTGG + Intergenic
1072418164 10:95266294-95266316 TTACTATATATTATTTATTTGGG - Intronic
1074071816 10:110078977-110078999 TTTCTTTATATTATGTATTTAGG - Intronic
1074276910 10:112012104-112012126 TTCCTATACATGATGTTTTAGGG + Intergenic
1075990553 10:126835087-126835109 TCCCTATTTACTAGGTATTCAGG - Intergenic
1076622321 10:131799112-131799134 ATACTATATTTTATATATTCTGG - Intergenic
1077355924 11:2117213-2117235 TTCCTATATATTAATTTTTGGGG + Intergenic
1079627889 11:22637011-22637033 TTATTATATATTATATATTCTGG + Intronic
1079964269 11:26961480-26961502 CTCGTATATAGTATCTATTCTGG - Intergenic
1080101266 11:28462574-28462596 TTCCTGTATTTTTTGTATCCTGG - Intergenic
1080140838 11:28918070-28918092 TTCCAATAAAATATGTATTAAGG + Intergenic
1080548235 11:33343180-33343202 GGCCAATATATTATCTATTCAGG - Intronic
1080738712 11:35043200-35043222 TTTAGACATATTATGTATTCAGG - Intergenic
1082755418 11:57070793-57070815 TTTTTATATATTCTATATTCTGG - Intergenic
1086825882 11:91495877-91495899 TACCTATAATTTATGCATTCTGG + Intergenic
1087238551 11:95749605-95749627 ATCCTATTTATTATTTATTAAGG + Intergenic
1087492671 11:98848080-98848102 TTCCTAGAAATTCTGTCTTCTGG - Intergenic
1088323681 11:108580171-108580193 TTTCAATTTATTGTGTATTCTGG - Intronic
1088965888 11:114720799-114720821 TTTCTATTTTTAATGTATTCAGG + Intergenic
1093979583 12:25461077-25461099 ATCATATATATAATATATTCAGG - Intronic
1094010399 12:25803126-25803148 TTCCTATTTATTTTGTATTATGG + Intergenic
1094440426 12:30470032-30470054 TTGCTATATATTTTGAAGTCAGG + Intergenic
1095305718 12:40637044-40637066 GTCCTATATCTTATGATTTCAGG - Intergenic
1095350701 12:41208175-41208197 TTCCAATAGATTATGAATCCTGG - Intronic
1095877008 12:47090071-47090093 TTCCTGTATATTAAGACTTCAGG - Intronic
1097534590 12:60850844-60850866 TTCCTATATAGAATGAGTTCAGG - Intergenic
1098352434 12:69577860-69577882 GTCCCAGATATGATGTATTCTGG - Exonic
1098485226 12:71013218-71013240 TTAATAAATATTTTGTATTCAGG - Intergenic
1098572154 12:72000350-72000372 TTCCTATTTATTATTGATTAGGG - Intronic
1098699152 12:73601210-73601232 TTCCTATGTAGTATGTTTTGTGG - Intergenic
1099050251 12:77773758-77773780 AAACTATATATTATGTATACTGG - Intergenic
1099246623 12:80200462-80200484 TTCATTTGTATTATGAATTCAGG - Intergenic
1100074492 12:90763186-90763208 TTCCTATATATTTTGCCTTCTGG + Intergenic
1100284368 12:93150963-93150985 TTCATATCTATTATGTAGACAGG - Intergenic
1100766932 12:97876792-97876814 TTCCTATTTCTTATGTTTTGTGG - Intergenic
1105272120 13:18887154-18887176 CTCCTATAAATTATGAAATCAGG - Intergenic
1105576379 13:21656883-21656905 TTCCTATGTCTTATGTTTTAAGG + Intergenic
1106998147 13:35512286-35512308 TTCCTAAATATTCTGTATCCTGG + Intronic
1107461171 13:40605071-40605093 TACATATATATGATATATTCAGG - Intronic
1107894418 13:44946746-44946768 TTCCTATATATTTAGAATCCAGG + Intronic
1107926117 13:45263556-45263578 TTACTACAGATTATGTAGTCAGG + Intronic
1108754166 13:53479713-53479735 TTTCTATATTTTGTGTATACAGG + Intergenic
1108770129 13:53690191-53690213 TTCCTATATAGAATATCTTCTGG + Intergenic
1111069210 13:83141707-83141729 TAGTTATATATTATGTAGTCTGG - Intergenic
1111698211 13:91652665-91652687 AGCCTATATATTGTTTATTCTGG + Intronic
1114848516 14:26353586-26353608 TTCCTAGATATTTTATATTGGGG + Intergenic
1115854281 14:37612720-37612742 TTCCTAAATTTTATGTTTTGTGG + Intronic
1116124687 14:40768440-40768462 TTTCTATATACTATGTATTGTGG - Intergenic
1116769224 14:49107960-49107982 TTCCCATATCTAATGCATTCAGG + Intergenic
1117250920 14:53936514-53936536 ATCGTATTTATTATCTATTCTGG + Intergenic
1124436124 15:29651318-29651340 AACCTAGATATTAGGTATTCTGG + Intergenic
1124949460 15:34303318-34303340 TTATTATATATACTGTATTCTGG + Intronic
1125438277 15:39672010-39672032 TTCCTATATTTTCTGGATGCAGG - Intronic
1126989120 15:54351128-54351150 TTCCAATTTATTATGTTTACTGG - Intronic
1127005360 15:54563094-54563116 TTGATATGTATTATGAATTCTGG + Intronic
1127431648 15:58915843-58915865 TCCCCATATATTCTGTTTTCTGG - Intronic
1127985315 15:64065621-64065643 TTCCTTAATTTTATGTATCCTGG - Intronic
1131372170 15:91891738-91891760 TTCCTATTTACTATATATTAAGG - Intronic
1132066414 15:98734759-98734781 TTCCTATTTATAATGTCTTTGGG + Intronic
1133615553 16:7473463-7473485 TACATATATATTATGTATAAAGG - Intronic
1135648451 16:24184984-24185006 TTTCTTTATATTAGCTATTCAGG - Intronic
1137909202 16:52359035-52359057 ATCCTATATATTTTGTTTTCTGG - Intergenic
1138064077 16:53922412-53922434 TTCCCATATATGGTGTCTTCTGG + Intronic
1138232372 16:55348062-55348084 TGCATATATATTATGTATAGGGG + Intergenic
1140416435 16:74776993-74777015 TTCTTAAATATTTTGTATTGCGG - Intergenic
1151109151 17:71654537-71654559 TGTCTATATATTATATAGTCTGG - Intergenic
1156907092 18:42366558-42366580 TTCCAAATTATTATTTATTCAGG - Intergenic
1158794791 18:60831654-60831676 TTGCTATATATTAGGTGTGCAGG + Intergenic
1168534303 19:57156217-57156239 TTCCTAGACATTCTCTATTCTGG - Intronic
927299835 2:21499490-21499512 TTTATAAATATTTTGTATTCTGG - Intergenic
929145153 2:38700384-38700406 TTGCTTTATATTATGTATCTGGG + Intronic
929481090 2:42308904-42308926 TTCATATATAGCATGTATTATGG + Intronic
930419281 2:51130557-51130579 TTCCTATATATTTTGGTATCAGG - Intergenic
931037075 2:58255461-58255483 TTCATATACATTATGTAATTTGG + Intergenic
931060868 2:58528214-58528236 TTCTTAAATATGCTGTATTCTGG + Intergenic
931251702 2:60536774-60536796 TTGCTATATATTAAGTATATAGG - Intronic
931497949 2:62831577-62831599 TTTATATATCTTATGTATCCTGG + Intronic
931685908 2:64792850-64792872 TTCCTTTATCTTCTGCATTCTGG + Intergenic
931871445 2:66464738-66464760 TTCCTAAATTTTATTTAGTCTGG - Intronic
932547829 2:72733692-72733714 TTCCTTTATATAATGAACTCTGG - Intronic
932603928 2:73151221-73151243 TTCATATATTTTATCAATTCTGG - Intronic
933331618 2:80899560-80899582 TTCTTATGTATTATGTTTTGAGG + Intergenic
937585873 2:123549070-123549092 TTCCTATTTATTGTGGACTCCGG + Intergenic
938808829 2:134832893-134832915 GTCCTCTATATTATTTATACTGG + Intergenic
939397307 2:141647337-141647359 TTCCTCTATCTTATTTAATCAGG - Intronic
939867312 2:147487268-147487290 TTCATAGATATTATGTAATCAGG - Intergenic
940419298 2:153460325-153460347 TTCCTTGACATTATGTTTTCAGG + Intergenic
940622716 2:156132755-156132777 TTCCTAAATATTATCTATTTTGG - Intergenic
940755967 2:157683860-157683882 TTTCTATATATTTTGTGTTGTGG - Intergenic
941372640 2:164685766-164685788 TTACTATAAATTATAAATTCTGG + Exonic
942336605 2:174894234-174894256 TTTATATATTTTATATATTCTGG - Intronic
942893844 2:181025473-181025495 TTCCTCTTTATTGTGTATACAGG + Intronic
943121081 2:183736965-183736987 TATCAATATTTTATGTATTCTGG + Intergenic
943154922 2:184163562-184163584 TCCTTATATATTATGTATTTTGG - Intergenic
943206717 2:184907847-184907869 TTCCTATATTTTATATTTTTTGG - Intronic
945202999 2:207303467-207303489 TTCTTATATATTTTGTGTACAGG - Intergenic
946902786 2:224388819-224388841 TTTCTATATTTTATGTATTGTGG - Intronic
1169492908 20:6086299-6086321 TTCCTATATTATTTGTATCCTGG + Intronic
1169495921 20:6115099-6115121 TCACTATATATTATCTATTCTGG + Intronic
1169747048 20:8953169-8953191 TTTCTATATGTTATGCACTCAGG - Intronic
1173444941 20:43109217-43109239 TTCCTATTTATAATGAAGTCTGG - Intronic
1174694050 20:52539579-52539601 TTCTTTTATATTATTTTTTCTGG - Intergenic
1177095746 21:16829895-16829917 TTCCTATAAATTATATTTTTTGG - Intergenic
1177671901 21:24243090-24243112 CTCCTATAAATTATTTATTGTGG + Intergenic
1178188072 21:30247203-30247225 ATCCTATATTTTAAGTATTCTGG - Intergenic
949614678 3:5739825-5739847 TTCGTATATTTTATTTATGCAGG - Intergenic
949645990 3:6094650-6094672 TTCATATATTTTATTTATTGGGG + Intergenic
951848449 3:27111051-27111073 ATCCTGTATATAATGTGTTCTGG + Intronic
951875167 3:27416501-27416523 TACATATATTTTATGCATTCAGG + Intronic
953596831 3:44323350-44323372 ATCTTATATATTATAAATTCTGG - Intronic
953893939 3:46779704-46779726 TTATTATGTATTATGTATTCTGG - Intronic
955107262 3:55909997-55910019 TACATATACGTTATGTATTCAGG + Intronic
956976287 3:74584274-74584296 TTCCTATATATTATCTCATCTGG - Intergenic
959002080 3:100976221-100976243 TTCATATTTATCATGTATTCTGG + Intronic
959143001 3:102508432-102508454 TTCCCATATATTTTGTTTTCAGG + Intergenic
959637879 3:108595698-108595720 TTACTAGAGATTATATATTCAGG - Intronic
959879866 3:111430812-111430834 CCCCAATATATTATCTATTCTGG - Intronic
960527083 3:118722320-118722342 TTTCTCTATATTATGTATTTTGG + Intergenic
963962983 3:151330959-151330981 TTCCTTTAGATTATGGATTTGGG - Intronic
964173271 3:153795898-153795920 TTAGTATCTATTATGTATTTAGG - Intergenic
965939456 3:174160652-174160674 TTCCTATATATTATATAGGAAGG - Intronic
967934095 3:194712695-194712717 TTCCTATATATTGGACATTCAGG - Intergenic
968163014 3:196442597-196442619 TTCCTATACTTTTTGTAGTCTGG - Intergenic
969555964 4:7910407-7910429 TTTCTATGTATTTTGAATTCTGG - Intronic
970661394 4:18289761-18289783 TTCCTATAAATTATGCATTCGGG - Intergenic
970828418 4:20306426-20306448 TTGCTATATATTATGCATAGGGG - Intronic
971520980 4:27550189-27550211 GGCCTATATATTACATATTCAGG - Intergenic
971807845 4:31383669-31383691 TTCGTATTTATTTTGAATTCTGG - Intergenic
971846646 4:31927132-31927154 TTCATATATATAATTTTTTCTGG + Intergenic
972236712 4:37143092-37143114 TCCTTTTATATTATATATTCTGG + Intergenic
973173891 4:47179634-47179656 TTCCTATATAGTATGTTTTAAGG + Intronic
973940853 4:55909216-55909238 TTCATATATATAATGTATGAAGG - Intergenic
974085164 4:57252553-57252575 TTCCTTGATTTTGTGTATTCAGG + Intergenic
974132938 4:57778477-57778499 TTCCTTTGTATTTTGTATTTTGG - Intergenic
975315172 4:72943951-72943973 TTCCTATTTAATATGTATTTTGG - Intergenic
975818860 4:78248659-78248681 TTCCCAGATATTTAGTATTCTGG + Intronic
976987370 4:91318411-91318433 TTCCAATATCTTATTTATTCAGG - Intronic
977102769 4:92838751-92838773 TTCCTCCATATTTTGTAATCTGG + Intronic
977788125 4:101064432-101064454 TTCATTTTTATTATCTATTCAGG + Intronic
979702030 4:123680345-123680367 TTCTTATTTATTATGTAATCAGG - Intergenic
979702118 4:123681646-123681668 TGTATATATATTATGTAATCAGG + Intergenic
979875962 4:125891526-125891548 TTCCTACATATTATTAATTTTGG - Intergenic
980454517 4:133021833-133021855 GTGCTATATATTTTGTATTATGG + Intergenic
980527342 4:134008767-134008789 ATCCTACATATTATGTCTTCAGG - Intergenic
981087505 4:140699165-140699187 TGCCTATTTATTTTGTCTTCTGG - Intronic
982762478 4:159302280-159302302 TTTTTATATTTTATTTATTCAGG - Intronic
982909846 4:161126382-161126404 TTACTATACATTAAGTATTCTGG - Intergenic
983115510 4:163811351-163811373 TTCCTAAATATTTTGTCTTAAGG + Intronic
983675279 4:170285309-170285331 TTCCTATGTATGAGGTTTTCTGG + Intergenic
983862817 4:172729099-172729121 TCCTTATATATTATATATTCTGG + Intronic
984002870 4:174271876-174271898 CTTATATATATTATGTATTTGGG + Intronic
984109271 4:175591616-175591638 ATTGTATAAATTATGTATTCAGG + Intergenic
985188364 4:187343427-187343449 TTACTATATATGATATATTCAGG - Intergenic
986385455 5:7229162-7229184 GTCTTACATATTATGTCTTCAGG - Intergenic
987817795 5:22926378-22926400 TTTGTATATATTATGTGTTGGGG + Intergenic
987844594 5:23266138-23266160 TCCCTCTATATTATGTGTTCAGG - Intergenic
988814181 5:34815999-34816021 TTCCTCAATATTCTGCATTCAGG - Intronic
989422289 5:41254064-41254086 TTCCTATATATATTGCAGTCAGG - Intronic
990632645 5:57687615-57687637 TTCCAATATATCATATAATCTGG - Intergenic
991347820 5:65688664-65688686 GTCCTATGTATTATGTATAGAGG - Intronic
991486416 5:67141660-67141682 TTCCTAAATATTATTTATAGGGG - Intronic
991770774 5:70038890-70038912 TTCCAATATATCATGAAATCAGG - Intronic
991850068 5:70914307-70914329 TTCCAATATATCATGAAATCAGG - Intronic
992173680 5:74128482-74128504 TTCCTATATATTCCTTTTTCAGG + Intergenic
992925182 5:81576261-81576283 TTCAAATACATTATGTTTTCTGG + Intronic
994164821 5:96597759-96597781 TTCATATATGCTATTTATTCAGG + Intronic
994296848 5:98100237-98100259 TACATATATAATATGTATTTGGG + Intergenic
994759879 5:103838539-103838561 TTCCAATATATTATTTGTTTTGG + Intergenic
994908588 5:105872417-105872439 TTCCTTTAAATTGTGCATTCAGG - Intergenic
995765829 5:115617682-115617704 TTCCTAAATATTCTGCATTTGGG - Intronic
996149458 5:120017651-120017673 TTCCTATCTACTATCTATTGTGG - Intergenic
996258324 5:121433715-121433737 TTCCTATAAAATATGTGTCCAGG - Intergenic
996262281 5:121487274-121487296 TTACTATAGATTATATATTTAGG + Intergenic
996496033 5:124157786-124157808 TTCCAATATATTTTTTATTGAGG - Intergenic
997039738 5:130237867-130237889 TTCCTCTTTATAATGTATTCTGG + Intergenic
997121875 5:131182856-131182878 TTCCTATATATTATGTATTCTGG + Intronic
997478580 5:134164957-134164979 ATTCCATATATTATGTATCCAGG + Intronic
998751349 5:145324868-145324890 TTCCTTTATATTATGAAGTTTGG - Intergenic
1002006923 5:176242459-176242481 TACATATATTTTATGCATTCAGG + Intronic
1002219456 5:177668171-177668193 TACATATATTTTATGCATTCAGG - Intergenic
1003861518 6:10326581-10326603 TTTCTATATTTTATTTATTCAGG - Intergenic
1004290440 6:14362252-14362274 TTCATATATTTTCTGAATTCTGG - Intergenic
1005248293 6:23914100-23914122 TTGCTATTTATTATTTATTAGGG + Intergenic
1005422500 6:25666760-25666782 TACCTATATTTTATTTATTCAGG - Intronic
1005674040 6:28136254-28136276 TTCCTTTAAATTCTGTACTCTGG - Intergenic
1008018606 6:46550141-46550163 TTCCTATAAACCATGTATTCCGG + Exonic
1009678903 6:66865111-66865133 TTGCTATATATTTTGAAATCAGG - Intergenic
1010268869 6:73898438-73898460 TTCCTATAAATCAAGTTTTCTGG - Intergenic
1010543213 6:77117995-77118017 TTTCTATATAGTATTTATTTTGG - Intergenic
1011586642 6:88933138-88933160 ATGCTATATTTTATGTATTATGG + Intronic
1011592937 6:88987981-88988003 CTCCTCTATTCTATGTATTCTGG - Intergenic
1012031459 6:94071744-94071766 TTCCTATATATATTGTTTGCTGG + Intergenic
1012259369 6:97069973-97069995 CCACTATATATTATGTATTTGGG - Intronic
1012708422 6:102565378-102565400 TTCCTTTACTTTATGTTTTCCGG - Intergenic
1013894735 6:115072947-115072969 TTTCTATATATTTAATATTCTGG - Intergenic
1014042102 6:116840107-116840129 TTACTATACATTATGTTTTTAGG - Intergenic
1014351197 6:120348404-120348426 TTACTATATAATATATATTTGGG + Intergenic
1014502983 6:122215794-122215816 TTCCTATACTTTATCTATTGTGG - Intergenic
1014640786 6:123907182-123907204 TTCCTATGAATTTTGTATTCAGG - Intronic
1014812163 6:125899622-125899644 TTCCTATTTAGTATGAATTTTGG + Intronic
1015002991 6:128242861-128242883 TGCCTATATATTGCCTATTCAGG - Intronic
1015416160 6:132951033-132951055 TTCCTATATATATTATATTTTGG - Intergenic
1016157402 6:140828565-140828587 TTCTTGTATATTTTGTATTGTGG + Intergenic
1019790201 7:3007173-3007195 TTCCTATATTTTTTCAATTCTGG - Intronic
1021327248 7:19288473-19288495 TTCCTAGAAATTATCTATGCTGG - Intergenic
1023987863 7:45107982-45108004 TTACTATATGTGATGAATTCTGG + Intronic
1024440824 7:49415740-49415762 TTGCAATAAATTTTGTATTCTGG - Intergenic
1024968049 7:55042687-55042709 CCCCTATATGTTATGTCTTCTGG - Intronic
1027507018 7:79028803-79028825 TTACTATATATTTTTTATTTTGG + Intronic
1027832467 7:83197201-83197223 TTCCTATATAAGATGCAGTCTGG - Intergenic
1027858301 7:83541268-83541290 TTTCTATATATTATGAAAGCAGG + Intronic
1027889052 7:83947392-83947414 TTCCTACATCTTACATATTCTGG - Intergenic
1027904601 7:84163676-84163698 TCCCTACATTTTATGAATTCAGG + Intronic
1028042398 7:86070585-86070607 TTCTTATATATTTTGGATACTGG + Intergenic
1028574356 7:92330330-92330352 TTAATATATATTAGGTATTACGG - Intronic
1030623002 7:111812628-111812650 TTCCTATCTATTTTGTCTTTGGG - Intronic
1031709827 7:125031642-125031664 TTACTATATTTGATGTATTAAGG - Intergenic
1031854259 7:126903117-126903139 TTCCTATATGTTCTGTTTTCAGG + Intronic
1031949283 7:127875336-127875358 TTGCTGTATATTATCTTTTCTGG - Intronic
1031978214 7:128107118-128107140 TCCTTAAATATTATGTAGTCTGG + Intergenic
1032349569 7:131148001-131148023 TTTCTATGTTTTAGGTATTCAGG + Intronic
1033250013 7:139750415-139750437 TTCCTATATATATAGTATTTTGG + Intronic
1034140649 7:148812347-148812369 TTGCTATAAATTATGTATTTAGG + Intronic
1035815312 8:2532787-2532809 ATTTTATATATTATGTATTTAGG + Intergenic
1037040282 8:14222554-14222576 TTCTGACAGATTATGTATTCTGG + Intronic
1037465697 8:19157961-19157983 TCACTATATATTTTGTATTTGGG - Intergenic
1037918296 8:22786195-22786217 CTCTAATACATTATGTATTCTGG + Intronic
1039651577 8:39345847-39345869 TTTTTATATATTAGGTACTCTGG + Intergenic
1040927171 8:52696696-52696718 TTCCTATATGAAATGTATTTTGG + Intronic
1041728690 8:61043182-61043204 TTCTTACCTAGTATGTATTCAGG - Intergenic
1041923293 8:63207325-63207347 TTCTTATAAATTATGTATAATGG + Intronic
1043010366 8:74873820-74873842 TTCCTGTAAATTTTATATTCAGG - Intergenic
1043055000 8:75426395-75426417 TTCTTATAAATTATCTCTTCTGG + Intronic
1044362893 8:91309482-91309504 TTATTATATATTATATATACTGG - Intronic
1045776635 8:105811238-105811260 TTTCTACATATGATGTAATCTGG + Intergenic
1046499541 8:115058264-115058286 TTTCTATTTATTATGCATTGAGG + Intergenic
1046574871 8:116014963-116014985 TGCCAATATATTGTGTTTTCTGG - Intergenic
1048052601 8:130832392-130832414 TTCCTATACATTAGGTATCTGGG - Intronic
1048568036 8:135624425-135624447 TTTCTATGTATTATGTTTTTGGG - Intronic
1050522338 9:6514170-6514192 TTCTTATATATTCTGAATACTGG + Intergenic
1050960933 9:11729903-11729925 TTCTATTATATTATGAATTCAGG + Intergenic
1050980785 9:12011994-12012016 TTCTTATATGTTATTTATTTTGG + Intergenic
1050998087 9:12245000-12245022 TCCCTATATAATATTTATTAAGG - Intergenic
1051168238 9:14289180-14289202 TTGGTATATATTATATATTTTGG - Intronic
1052076605 9:24149820-24149842 TTCCTACATATTTTATTTTCTGG + Intergenic
1052608786 9:30741614-30741636 TTGCTATATATTATAGATTTTGG + Intergenic
1053448807 9:38175457-38175479 TTCATATATATTTTTTATTGGGG - Intergenic
1055370752 9:75596237-75596259 CTCCTAAATTTTATGTATTCAGG + Intergenic
1056498857 9:87188501-87188523 TTCCTATATAATCTTTATTCTGG - Intergenic
1058007520 9:99933881-99933903 TTACTAAATATTAAGTATTTGGG - Intronic
1058760556 9:108127248-108127270 ATGCTATGCATTATGTATTCAGG + Intergenic
1186637428 X:11421515-11421537 TTCCTCTATATAATGTCATCTGG - Intronic
1188422081 X:30002517-30002539 TTCCTATAGATTCTGAATTCTGG - Intergenic
1188710211 X:33387555-33387577 TTCCTGTAAATTATATTTTCTGG - Intergenic
1189139768 X:38590451-38590473 TTCCTTTTTATTCTGTTTTCTGG + Intronic
1193272771 X:79548090-79548112 TTCCTTTTTATTACATATTCAGG - Intergenic
1194330277 X:92575030-92575052 TTCTTATATTTTAAGCATTCTGG - Intronic
1194532214 X:95064372-95064394 TTCATGTATTTTATGTATTTAGG - Intergenic
1194786272 X:98087626-98087648 TTCTTATATATTCTGGATACAGG - Intergenic
1199840911 X:151647653-151647675 TTCCTAAATATTACGTATTTTGG + Intronic
1200325342 X:155232257-155232279 TCTTTATATATTATGTATTTCGG + Intronic
1200357027 X:155562576-155562598 TTCCTTTCTATCATATATTCAGG + Intronic
1200638985 Y:5694206-5694228 TTCTTATATTTTAAGCATTCTGG - Intronic
1201685412 Y:16696477-16696499 TCCCCAAATTTTATGTATTCTGG + Intergenic
1201925422 Y:19281169-19281191 TTCGAACTTATTATGTATTCTGG + Intergenic