ID: 997125303

View in Genome Browser
Species Human (GRCh38)
Location 5:131220650-131220672
Sequence TGCGATCACAAAATAAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997125302_997125303 28 Left 997125302 5:131220599-131220621 CCATTATAGATGTAGAAAACAAG No data
Right 997125303 5:131220650-131220672 TGCGATCACAAAATAAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997125303 Original CRISPR TGCGATCACAAAATAAATCA AGG Intergenic
No off target data available for this crispr