ID: 997127500

View in Genome Browser
Species Human (GRCh38)
Location 5:131242902-131242924
Sequence CATTGTGAACAAAGGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997127493_997127500 26 Left 997127493 5:131242853-131242875 CCCAGAAGGTTCAAGGGAGGTGG No data
Right 997127500 5:131242902-131242924 CATTGTGAACAAAGGGCACAGGG No data
997127491_997127500 29 Left 997127491 5:131242850-131242872 CCTCCCAGAAGGTTCAAGGGAGG No data
Right 997127500 5:131242902-131242924 CATTGTGAACAAAGGGCACAGGG No data
997127495_997127500 25 Left 997127495 5:131242854-131242876 CCAGAAGGTTCAAGGGAGGTGGT No data
Right 997127500 5:131242902-131242924 CATTGTGAACAAAGGGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997127500 Original CRISPR CATTGTGAACAAAGGGCACA GGG Intergenic
No off target data available for this crispr