ID: 997135143

View in Genome Browser
Species Human (GRCh38)
Location 5:131317546-131317568
Sequence TGATGTAGTAAGAGGGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997135143 Original CRISPR TGATGTAGTAAGAGGGATCT TGG Intronic
905715580 1:40146694-40146716 TGATGTATTGAGAGATATCTAGG + Intergenic
907413647 1:54299452-54299474 TGGTGGAGTAAGAGGGACCCTGG - Intronic
910907957 1:92201565-92201587 TGTTGTAGAAAGTGGGATTTGGG - Intergenic
911533761 1:99077061-99077083 TTTTGTTGTAAGAAGGATCTGGG - Intergenic
911698313 1:100920029-100920051 TTATGTAGTAAGAAGGCTTTAGG + Intronic
915556450 1:156663502-156663524 TGAAGAAGGAAGAGGGCTCTAGG + Intergenic
915671615 1:157493863-157493885 AGATGTAGTATGAAGGAGCTGGG + Intergenic
917208207 1:172600755-172600777 TGCTTTAGTTAGAGTGATCTTGG + Intronic
919443893 1:197676870-197676892 TGATCTTGTAAGAGAGAACTAGG + Intronic
919456081 1:197820466-197820488 TGAGGTAGAAAGAGAGATCAGGG + Intergenic
924238886 1:242022461-242022483 TTATGTAGCAAGGGGGAGCTGGG - Intergenic
924289152 1:242520507-242520529 AGCTCTGGTAAGAGGGATCTGGG - Intronic
1064939123 10:20713133-20713155 TGATGGAGTAAGAGGTATTTGGG + Intergenic
1071569370 10:86688278-86688300 CGATGTAATAAGAGGGATGGAGG + Intronic
1071789722 10:88941271-88941293 TGAGGTAGTCAGTGAGATCTCGG + Exonic
1079870905 11:25796612-25796634 TGACCTAGTAAGATGGCTCTAGG + Intergenic
1080140108 11:28907326-28907348 TGTTGTTGTAAGAGTGCTCTGGG - Intergenic
1080252462 11:30249474-30249496 TGATGTTGTCAGAGGGACCATGG - Intergenic
1080562967 11:33480857-33480879 TGATGTCCTAGGAGGGAGCTGGG - Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1083378792 11:62247422-62247444 TGATGAAGTGAGAGAGAACTTGG - Intergenic
1089480000 11:118796925-118796947 AGATGTAGTAAAAGGAAACTGGG - Intergenic
1089769020 11:120789367-120789389 GGATGAGGTAAGAGGGCTCTTGG - Intronic
1092966876 12:13652483-13652505 TGATGTAGGAGGAGGAATATTGG + Intronic
1098104882 12:67059156-67059178 TGATGGAGTTTGTGGGATCTTGG - Intergenic
1098717256 12:73845959-73845981 TGATGTAAAAAGAGTGATCAAGG + Intergenic
1100989560 12:100237589-100237611 TGATGTGGTAACAGGAATATGGG - Intronic
1101292872 12:103389093-103389115 TGCTCTGGTAAGAGGGATTTGGG - Intronic
1102856819 12:116301396-116301418 CTTTGTAGTCAGAGGGATCTGGG + Intergenic
1102977936 12:117220033-117220055 GGATGTAGGAAAAGGGACCTGGG + Intronic
1103763882 12:123268809-123268831 TGATGTAGTTAGGGGGCTCTGGG - Intronic
1104184071 12:126411340-126411362 TGAGGTGGTAAGAGTGAGCTTGG + Intergenic
1106063925 13:26325524-26325546 AGATGAAGTATGAGGTATCTCGG + Intronic
1109274140 13:60285704-60285726 TGATTTAGTAAGACTGACCTGGG - Intergenic
1110858933 13:80326681-80326703 GGGTGTAGTAAGTGGGATCAGGG - Intergenic
1111213115 13:85106639-85106661 TAATGTACAAAGAGGAATCTGGG + Intergenic
1111585320 13:90276551-90276573 TGATGTAGTTGGAAGCATCTGGG - Intergenic
1113114127 13:106856991-106857013 CCATGGAGAAAGAGGGATCTTGG - Intergenic
1114663069 14:24361420-24361442 TTGTGTAGAAAGAGAGATCTGGG + Intergenic
1115364991 14:32547894-32547916 TGATCTTTTAAGAGGCATCTGGG + Intronic
1118227090 14:63911992-63912014 TGATGTATTTAGAGGAATCGTGG + Intronic
1118576760 14:67249316-67249338 TAATGTAGTAAAAGGAAGCTTGG + Intronic
1119501155 14:75128352-75128374 AGACCTAGTAAGAGGGAGCTGGG + Intergenic
1124831947 15:33157514-33157536 CAATGTAGTGAGAGAGATCTGGG - Intronic
1125066570 15:35493730-35493752 TGGTGTAGGAAGAGGGTTGTTGG + Intronic
1126607989 15:50500004-50500026 TGATGTATTAAGAGGGTTAAAGG + Exonic
1128673497 15:69592356-69592378 TGATGTCTTAATAGGGGTCTTGG + Intergenic
1133382645 16:5344299-5344321 TGATGTAGAAAGAGGGAGCTGGG - Intergenic
1135335380 16:21597527-21597549 TGCTGTAGTCAGAAGGATTTTGG - Intronic
1136991324 16:35152919-35152941 TGCTGTAGTCAGAGGGTCCTAGG - Intergenic
1137855136 16:51787028-51787050 CCATGTAGTGAGAGGGATTTAGG - Intergenic
1139599260 16:67976758-67976780 TGATGTGGTCAAAGTGATCTAGG + Exonic
1139790690 16:69431924-69431946 TAATTTAATAAGAGTGATCTGGG + Intronic
1143396354 17:6601225-6601247 TGAAGTAGGGAAAGGGATCTAGG - Intronic
1145025453 17:19464903-19464925 TGATGTTGTAAATGGGATATGGG - Intergenic
1147462184 17:40580350-40580372 CAATGTAGTAAGAGGTAACTAGG + Intergenic
1149047765 17:52267474-52267496 AGATGTGGTCAGAGGGATGTTGG - Intergenic
1150050660 17:61958973-61958995 TGATGGAGTCAGAGAGACCTGGG - Intronic
1152323777 17:79623942-79623964 TGAAGAAGGAAGAGGGAGCTGGG + Intergenic
1153962214 18:10149428-10149450 TGATGTGGGAAGAGGCATCGCGG - Intergenic
1156502497 18:37568347-37568369 TGATGTTGGAAGAGATATCTTGG - Intergenic
1157467470 18:47959584-47959606 TGGTCTATTAAGAAGGATCTGGG - Intergenic
1166070176 19:40382536-40382558 TGCTCTAGCAAGAGAGATCTGGG - Intronic
926422616 2:12715205-12715227 AGATGAAGAAACAGGGATCTAGG + Intergenic
929395201 2:41514509-41514531 TGGTGTAGAAACAGGGGTCTTGG - Intergenic
929834863 2:45386158-45386180 TGATGAAGTTGGAGGGATGTTGG - Intergenic
930957419 2:57218597-57218619 TGATTTAGTAACAGGATTCTGGG - Intergenic
931270109 2:60694042-60694064 TGCTTAAGTAAGAGGGAACTGGG - Intergenic
932481558 2:72042426-72042448 TGGTGTGGTAAGAGGGATAAAGG + Intergenic
932829394 2:74974420-74974442 TGATATAGTAACATGGATCTGGG - Intergenic
938677545 2:133654056-133654078 TGATGTAGTAAAAATGATGTCGG - Intergenic
938745089 2:134270198-134270220 TGATGTATTTAGTAGGATCTGGG + Intronic
943381514 2:187155680-187155702 TGATGTAGTCACACGGTTCTTGG + Intergenic
944467438 2:200017431-200017453 ACATGTTGTAAGAGGGACCTAGG - Intergenic
944532412 2:200680475-200680497 TGATGTAGTGAGAGGATTCCTGG - Intergenic
1171320896 20:24243291-24243313 TGTTGGAGTAAGAGAGAGCTGGG - Intergenic
1173264626 20:41468064-41468086 TGATTTAGAAAGAGTGGTCTAGG - Intronic
1176935666 21:14863939-14863961 TGATGATGTAAGAGAGAGCTGGG - Intergenic
1178110269 21:29363222-29363244 TGTTGTAGTAAGCGGGAGATGGG + Intronic
949489031 3:4569599-4569621 TTGTGTAGTAAGAGGGATCATGG + Intronic
949543737 3:5054464-5054486 TGAGGTAGGAAGAGGGGACTTGG - Intergenic
951646106 3:24892909-24892931 TGATGTTGTAAGTGGTCTCTTGG + Intergenic
953005131 3:38970919-38970941 TGATGGAGGAAGATGGGTCTAGG - Intergenic
953753286 3:45625751-45625773 TGATGCAGTAAGAAGGCCCTTGG + Intronic
955047351 3:55372723-55372745 TGAATTTGTAAAAGGGATCTAGG + Intergenic
955794037 3:62617276-62617298 TGATGTGGTAGCAGGGATTTGGG + Intronic
956020330 3:64926966-64926988 TGATGTAGAATAAAGGATCTAGG - Intergenic
957966968 3:87334594-87334616 TCTTGTAGTATGAGGGATGTTGG + Intergenic
958723482 3:97875250-97875272 TGATGTAGTTAGAGAGTTCTTGG + Exonic
963966315 3:151374849-151374871 TCATCTGGTAAGAGGGATATGGG - Intronic
964203555 3:154145493-154145515 TGATGGAGACAGAGTGATCTTGG + Intronic
965957953 3:174394406-174394428 CGATGTCGGAAGAGGTATCTTGG - Intergenic
967213432 3:187189569-187189591 TTATGGAGTAAAAGGGATCTTGG - Intergenic
967472968 3:189884351-189884373 TGAAGTAGTAAGAGAAATGTAGG - Intronic
969978065 4:11124849-11124871 TGAAGTAGTAAGAAGGATTCAGG + Intergenic
979285547 4:118920152-118920174 TGAAGGAGAAAGAGGAATCTGGG + Intronic
979722291 4:123915299-123915321 TGATATAGTAAGTGTTATCTAGG + Intergenic
979912667 4:126389008-126389030 TTATGTAGTAGCAGGGACCTGGG + Intergenic
979951980 4:126904599-126904621 TGAAGAAGTAAGAGGAATTTTGG - Intergenic
981136708 4:141219445-141219467 TCATTGAGGAAGAGGGATCTGGG - Intergenic
981142097 4:141280581-141280603 TTTTGTAGTCAGAGAGATCTTGG + Intergenic
982894630 4:160903030-160903052 TGAAGTAGTAAGAGTGATAATGG - Intergenic
983416697 4:167465594-167465616 TGATGTATTATGAGGGTTGTGGG - Intergenic
984908189 4:184649131-184649153 TGATTTAGGGAGAGGGACCTGGG - Intronic
985078265 4:186240245-186240267 TGATGTAGTTACAGTGATATAGG + Intronic
991231335 5:64336125-64336147 TGAAGTAGAAAGAAGGATATGGG - Intronic
993769738 5:91911383-91911405 TGATGTAATGAGAACGATCTGGG - Intergenic
997135143 5:131317546-131317568 TGATGTAGTAAGAGGGATCTTGG + Intronic
1002378740 5:178809091-178809113 TGATCTAGTGAAAGAGATCTGGG + Intergenic
1005871125 6:29975047-29975069 TGAGGAAGTAGGAGGGAACTTGG + Intergenic
1007234737 6:40382442-40382464 AGATGGAGTAAGAGGGATCTAGG - Intergenic
1009555478 6:65159337-65159359 TAATGTAGAAAGAGTGCTCTAGG + Intronic
1011981125 6:93380034-93380056 TGATTTAGTATGAAGAATCTGGG + Intronic
1022707638 7:32819535-32819557 TGATGTAGTAAAAAGTATATTGG + Intergenic
1022915276 7:34943471-34943493 TGATGTAGTAAAAAGTATATTGG - Intronic
1023805603 7:43870645-43870667 TCATGTAATCAGAGGAATCTTGG - Intronic
1028483510 7:91333767-91333789 TGATGTAATAAGAAGGAATTAGG - Intergenic
1030726686 7:112934618-112934640 TATTGTAGTAGGAGGAATCTAGG - Intronic
1031192800 7:118576247-118576269 TGATTTAGTAGGAGAGATCTTGG + Intergenic
1031223713 7:119007400-119007422 TGATGTAGTCTGACAGATCTTGG - Intergenic
1037064360 8:14558277-14558299 AGATAGAGTAAGAGGGAGCTGGG + Intronic
1037412445 8:18613083-18613105 TGATGTAGTGAGAGTCATTTTGG - Intronic
1037503567 8:19507929-19507951 TGATATAGAAAGATGCATCTAGG - Intronic
1039567581 8:38562464-38562486 TGATGTACTGAGAGGTCTCTGGG + Intergenic
1043545635 8:81312714-81312736 TGATGTAGATAAAGGTATCTGGG - Intergenic
1047770463 8:128026542-128026564 AGATGGAGACAGAGGGATCTGGG - Intergenic
1049048007 8:140168132-140168154 TGAGGTAGTTAAAGGTATCTAGG + Intronic
1054963001 9:70990509-70990531 TGATAAAGGAACAGGGATCTAGG - Intronic
1055731919 9:79287244-79287266 TGTTGGAGTCAGAGGCATCTGGG + Intergenic
1056998977 9:91490046-91490068 AGATGTAGTCAGAAGTATCTTGG - Intergenic
1057105078 9:92407258-92407280 TGATGTAGGATAAGGGATTTGGG - Intronic
1186751640 X:12627567-12627589 TGAAGTAGAAAAAGGGATTTGGG + Intronic
1188390896 X:29617804-29617826 AAATGTATTAATAGGGATCTAGG - Intronic
1193950478 X:87791302-87791324 TGATGTGGTAATAGAGATATGGG - Intergenic
1197690321 X:129493561-129493583 TGGTGTAGTGAGAGGCACCTTGG + Intronic
1198788881 X:140320524-140320546 TGATGGAATAAGAGGGATACAGG + Intergenic
1199654952 X:149985229-149985251 TTATGTAGTAATATGGATATTGG + Intergenic
1201352861 Y:13065225-13065247 TGCTGTAGTAAAAGGGATTGAGG - Intergenic