ID: 997142480

View in Genome Browser
Species Human (GRCh38)
Location 5:131397524-131397546
Sequence CAGATTGAAAAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 743
Summary {0: 1, 1: 0, 2: 6, 3: 63, 4: 673}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997142480_997142483 -10 Left 997142480 5:131397524-131397546 CCTTCTTCCCTCTTTTCAATCTG 0: 1
1: 0
2: 6
3: 63
4: 673
Right 997142483 5:131397537-131397559 TTTCAATCTGATATTCCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997142480 Original CRISPR CAGATTGAAAAGAGGGAAGA AGG (reversed) Intronic
901249882 1:7770125-7770147 CAGATGGATTAGATGGAAGAGGG - Intergenic
902036622 1:13462749-13462771 CTGATTGGGAAGAGGGAAGGAGG + Intergenic
902106949 1:14045586-14045608 CAAATTGGAAACAGGGAACATGG - Intergenic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902931641 1:19735577-19735599 GAAACTGGAAAGAGGGAAGAGGG - Intronic
902986529 1:20157763-20157785 CAGAGTGAAAAGATGGAAGTTGG + Intergenic
904090472 1:27941534-27941556 GACATTGTAAACAGGGAAGATGG + Intronic
904480732 1:30791713-30791735 GAGAAGGAAGAGAGGGAAGAAGG + Intergenic
904876917 1:33662446-33662468 TAGATGGAAAAGAGAGAAAAGGG - Intronic
905055410 1:35089494-35089516 AAGATGGAAATGAGGGAAGGTGG + Intronic
905256062 1:36685849-36685871 CTGATTGACATCAGGGAAGATGG + Intergenic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905520057 1:38590662-38590684 CAAATTGAAAAGAAGTAAAAAGG + Intergenic
906924568 1:50101278-50101300 CAGGTTTAAAAGAGGAAAAACGG + Intronic
907022234 1:51079475-51079497 CACAGGGAAAAGAGAGAAGAAGG - Intergenic
907091862 1:51732559-51732581 GAGATGGAAAATAAGGAAGATGG - Intronic
907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG + Intronic
907995827 1:59631267-59631289 GAGATGGCAAAGAGAGAAGAGGG - Intronic
908502838 1:64761369-64761391 CAGTTTCAAAAGAGGGAGAAGGG + Intronic
908756050 1:67469861-67469883 CAAACTGAAAAGAGTGAAAAAGG + Intergenic
908777351 1:67653379-67653401 CACAGTAACAAGAGGGAAGAAGG - Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
909151677 1:72013490-72013512 CAAACTGAAAAGTGGCAAGATGG - Intronic
909647568 1:77934621-77934643 CAGAGTCCGAAGAGGGAAGAAGG - Intronic
909714288 1:78689155-78689177 TAGAATGAAAAGAAAGAAGAAGG - Intergenic
909987993 1:82186149-82186171 CAGATTGAAATGGGGGTAGGGGG - Intergenic
910161907 1:84282061-84282083 TCAATTGAAAAGAGGCAAGAAGG - Intergenic
910171330 1:84380477-84380499 AAGAAAGAAAAGAAGGAAGAAGG + Intronic
910525628 1:88174622-88174644 CTGATTGACACCAGGGAAGATGG + Intergenic
911125747 1:94339628-94339650 CAGTTTGCAAAGAGGAGAGATGG - Intergenic
911132543 1:94404399-94404421 AAGATGGAAGAGAGGAAAGAAGG - Intergenic
911382482 1:97132623-97132645 CACATGAAAAAGATGGAAGAAGG - Intronic
911538152 1:99125241-99125263 GAGATTGAAGGGTGGGAAGAGGG - Intergenic
912193431 1:107368225-107368247 GAGAAGGAAAAGAAGGAAGAGGG - Intronic
912514082 1:110207262-110207284 CAGGTTTCAAAGAAGGAAGATGG + Intergenic
913424405 1:118711358-118711380 GAGATTGCAAAGAGGGGAAAGGG + Intergenic
916304363 1:163312490-163312512 TAGGTTGAAAAGAGGGCAAAGGG + Intronic
916564195 1:165958862-165958884 AAGATGGATGAGAGGGAAGATGG + Intergenic
917622513 1:176810980-176811002 CAGATAGAAAAGACTGAGGAAGG - Intronic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
918660861 1:187086942-187086964 TAGATTAAAAAGAGGAAATATGG - Intergenic
918944992 1:191052096-191052118 CAGATGAAAAAAAGTGAAGAGGG + Intergenic
919307038 1:195855517-195855539 CAGGTAGAAAAGAGGAAAAAGGG + Intergenic
919594568 1:199546063-199546085 CAGCTGAAAAAGAAGGAAGAAGG + Intergenic
919613418 1:199775392-199775414 CAGATTGAAAAGTACAAAGATGG + Intergenic
919730244 1:200909022-200909044 CAGATGGAAAAGTGGAAAGGTGG + Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920376716 1:205512708-205512730 CAGATTGGAATGAGGAAAGTTGG + Intronic
921431130 1:215067427-215067449 CTCATTGTCAAGAGGGAAGAGGG + Intronic
921825936 1:219671953-219671975 CAGTTTGCATAGAGGGAAGCAGG - Intergenic
921857676 1:220004562-220004584 CTGAGTGAAAAAAGGGATGAAGG + Intronic
921898426 1:220424770-220424792 CAGACTAAAAGGAGGGAAGTTGG - Intergenic
922794983 1:228335425-228335447 GAGAATGAAAAGAGGAAGGAGGG - Intronic
923247568 1:232147399-232147421 AAGAAAGAAAAGAGGGAAGAAGG + Intergenic
923289633 1:232531854-232531876 CAGATAGAAAGGAAGGGAGAGGG + Intronic
923844431 1:237713165-237713187 CTGATGGAAAAGAGGGAAAAGGG - Intronic
923891331 1:238218197-238218219 CAAATTGAGAAGAAGGAAGTTGG - Intergenic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924166624 1:241289844-241289866 CTGAGTGAGAAGAGGAAAGATGG + Intronic
924181727 1:241445791-241445813 CAGTTTCAAAAGAGGGACCAAGG + Intergenic
924646717 1:245884619-245884641 GTGATTGACAAAAGGGAAGATGG + Intronic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
924945543 1:248844323-248844345 AAGTTTGGAAAGAGGGAAGGGGG - Intronic
1063168815 10:3487489-3487511 CAGACTTCAAGGAGGGAAGAGGG - Intergenic
1063621021 10:7649182-7649204 GAGAATGAAAAGAAGGGAGAAGG - Intronic
1064469605 10:15622276-15622298 GAGAGTGAGAAGTGGGAAGAAGG - Intronic
1064950112 10:20839119-20839141 AAGATTGAAAAACTGGAAGAAGG - Intronic
1065144237 10:22751831-22751853 CAGGTTGAATCAAGGGAAGAAGG - Intergenic
1065211371 10:23406653-23406675 CAGCTTGAGAAGGAGGAAGAGGG + Intergenic
1065538155 10:26734549-26734571 CCCATTGAAAGGAGGGAAAAGGG + Intronic
1065898808 10:30187108-30187130 CAGATTGGATAGTGGGTAGACGG + Intergenic
1066096569 10:32077876-32077898 TAGTATGAAAAGTGGGAAGAGGG + Intergenic
1066448496 10:35506562-35506584 CAGCATGAAGAAAGGGAAGAAGG - Intronic
1067279328 10:44859466-44859488 CAGATTAGAAAGAGAAAAGAGGG + Intergenic
1067721726 10:48732412-48732434 GAGAATGAAAGGAGGGAAGGTGG - Intronic
1067807912 10:49405909-49405931 GAGAAGGAAAAGGGGGAAGAGGG - Intergenic
1069018306 10:63457176-63457198 CAAATTGAAAAGAATGGAGACGG + Intronic
1069144385 10:64871860-64871882 CCCATTAAAAAGTGGGAAGAAGG + Intergenic
1069196476 10:65556955-65556977 CAGAATGAAAAGCAGGAAAAGGG + Intergenic
1069204946 10:65669751-65669773 AATATAGAAAATAGGGAAGAGGG + Intergenic
1069326964 10:67243014-67243036 AATATTGTAAAGAGGGAATATGG - Intronic
1070029179 10:72660736-72660758 AAGAATGAAAGGAGAGAAGATGG + Intergenic
1070346663 10:75549775-75549797 GAGATTGAAAAGTGGGCACAAGG - Intronic
1070949634 10:80420440-80420462 GAGATTGAGAAGAAGGAAGAAGG - Intronic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071689174 10:87797425-87797447 CAGATGGCAAAGGGGGAAGGAGG - Intronic
1071699363 10:87913666-87913688 CAGAATAAAAAGAGAGAAAAGGG - Intronic
1071897236 10:90080958-90080980 CAGATGGCAAAGGGGGAAGGAGG - Intergenic
1071970078 10:90896101-90896123 GAGATAGAAAAGAGGGAATGAGG + Intronic
1072286138 10:93917363-93917385 CAGTTTAAAAAAAGGAAAGAGGG - Intronic
1072434245 10:95400974-95400996 CAGATTGCACAGAGGGTTGAAGG + Intronic
1072702189 10:97650675-97650697 GAGATGGAGAAGAGGGAAAAAGG + Intronic
1072937622 10:99728671-99728693 CAGATTCAAATTAGGGATGAGGG - Intronic
1073370780 10:102987070-102987092 CAAATTTAAAAGATGGAAGCAGG + Intronic
1074300398 10:112227828-112227850 CAGACAGGCAAGAGGGAAGAGGG - Intergenic
1075102138 10:119513876-119513898 CAGATGGACAAGAGGGAATCTGG + Intronic
1075293692 10:121253553-121253575 AAGAATGAAAAGTGGGAAAATGG + Intergenic
1075389930 10:122084720-122084742 CACATTGGAAATAAGGAAGATGG + Exonic
1075963005 10:126585438-126585460 AAGAAGGAAAGGAGGGAAGAAGG + Intronic
1075969847 10:126643157-126643179 CAGATTAAAAATAGGTGAGAAGG + Intronic
1076199690 10:128548040-128548062 AAGAAGGAAAAAAGGGAAGAAGG + Intergenic
1076242595 10:128920908-128920930 CAGAAGGAAAAGAGCGAAGCTGG + Intergenic
1076464120 10:130666679-130666701 CAGGCTGAAAAGAGGGAAAGAGG + Intergenic
1077841165 11:5976196-5976218 AAGAATAAAAAGAGGGAAGGAGG + Intergenic
1077892281 11:6427924-6427946 CAGCATGAAAAGGGGGAAAATGG + Intergenic
1077984190 11:7333882-7333904 GAGATGGAAATGTGGGAAGAAGG + Intronic
1078032507 11:7767248-7767270 CACATTCAAAAGCTGGAAGAAGG + Intergenic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1078731655 11:13980341-13980363 CAGATAGAAAAAAAGAAAGAAGG - Intronic
1079676753 11:23237589-23237611 CAGATTAAAAAGATGGGAGAGGG + Intergenic
1080032862 11:27680277-27680299 GAGAATGAAAAGAGGGAGGAAGG + Intronic
1083081291 11:60096259-60096281 CAGATTGACAAGTAGGAAGTGGG + Intronic
1083269626 11:61565245-61565267 CAGATGGAAATGGGGGAAGATGG + Intronic
1083330536 11:61896388-61896410 CAGATGGAAGAGAGGAAAGCAGG - Intergenic
1084406203 11:68975053-68975075 CAGATTGAAGACAGGGAAGAGGG + Intergenic
1084486579 11:69451682-69451704 AAGGAAGAAAAGAGGGAAGATGG + Intergenic
1084543893 11:69804184-69804206 ATGGTTGAAAAGATGGAAGATGG + Intergenic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1085774919 11:79357042-79357064 CAGAGTGAAAGAAGAGAAGAGGG - Intronic
1085814773 11:79726265-79726287 AAGAGTGGAAAGTGGGAAGAGGG - Intergenic
1086124536 11:83336796-83336818 GAGGTTGAAACGAGGGGAGAAGG + Intergenic
1088299995 11:108347631-108347653 CAGATTCAAAAGAAGGAATCAGG + Intronic
1089072239 11:115709722-115709744 GAAAATGAAAAGAGGAAAGAGGG - Intergenic
1089715859 11:120358442-120358464 CTGACTGATAAGATGGAAGATGG + Intronic
1089932622 11:122329311-122329333 TACTTTGCAAAGAGGGAAGAGGG + Intergenic
1090204083 11:124875359-124875381 TGGATGGACAAGAGGGAAGAAGG + Intronic
1090887611 11:130893028-130893050 AAGACACAAAAGAGGGAAGAAGG + Intronic
1090941610 11:131392607-131392629 CAGGTTGAAGAGAGGGCAGGAGG + Intronic
1090988892 11:131798353-131798375 CATCTAGGAAAGAGGGAAGATGG + Intronic
1091069169 11:132547193-132547215 CACTTTTCAAAGAGGGAAGAAGG - Intronic
1091230016 11:133982203-133982225 CAGATTGCGAAGCGGGAACATGG + Intergenic
1091345781 11:134853065-134853087 CACAGTGCAAAGAGGGAACAAGG + Intergenic
1091770716 12:3149391-3149413 CAGGTAAAAAAGAGAGAAGAAGG - Intronic
1091831183 12:3552254-3552276 CAGGTGGTAAAGAGAGAAGAGGG + Intronic
1091901962 12:4151526-4151548 GAGAAAGAAAAGAGGGAAGGAGG - Intergenic
1092019207 12:5186467-5186489 CACATAGAGGAGAGGGAAGAAGG - Intergenic
1092041253 12:5386672-5386694 TGGAGAGAAAAGAGGGAAGATGG - Intergenic
1092334298 12:7615153-7615175 GAAAAAGAAAAGAGGGAAGAAGG + Intergenic
1093203613 12:16220392-16220414 AAGATTGAAAGGATGGAAGGTGG - Intronic
1094036308 12:26075612-26075634 CAGAATGAAAGAAGTGAAGAAGG + Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094337570 12:29377586-29377608 CAGATTGAAAATATTCAAGAAGG - Intronic
1094440737 12:30473326-30473348 AAAATTGAAAAGAAGGAGGAAGG + Intergenic
1095353006 12:41237032-41237054 CAGATTGCAAAAAGGCAAGAAGG + Intronic
1095398238 12:41785770-41785792 AAGAATTAAAAGAGGCAAGAGGG - Intergenic
1096753235 12:53776678-53776700 CAGATAGAAAGGAGTGAGGAGGG + Intergenic
1096871402 12:54594755-54594777 CAGACACACAAGAGGGAAGAAGG - Intergenic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1096971457 12:55669688-55669710 GAGATTGAAATGAGCCAAGATGG + Intergenic
1096985796 12:55756163-55756185 CAGACAGAAAAGAGGGAAAAGGG + Exonic
1097811205 12:64021126-64021148 CAGAATGGAAACAGGGAAGAAGG + Intronic
1098098801 12:66990478-66990500 AAGAGAGAAAAGAGGGAAGAAGG + Intergenic
1098167205 12:67710718-67710740 CAGAATGAGAGGAGGGAAGGAGG + Intergenic
1098167784 12:67715809-67715831 GTGATGGCAAAGAGGGAAGAGGG + Intergenic
1098202986 12:68076962-68076984 CACATTCAAAACAAGGAAGATGG + Intergenic
1098692797 12:73510310-73510332 CACTATGAAAAGAGGGAAGGTGG + Intergenic
1099278751 12:80614671-80614693 AAGATCGATTAGAGGGAAGACGG + Intronic
1099637325 12:85230505-85230527 GAGATTGGAAAGAGGTAATAAGG - Intronic
1099867108 12:88296868-88296890 AAAATTGAAAAGTGTGAAGAAGG - Intergenic
1101200231 12:102427809-102427831 CAGATTGAACACAGGAGAGAGGG + Intronic
1101851928 12:108410197-108410219 CAGATTGAATCAAGGGAAGAAGG - Intergenic
1102547569 12:113667661-113667683 CAGAGAGAAAAGAGGGGAGATGG - Intergenic
1103073573 12:117964538-117964560 CAGATTGGACAGAGAGAAGGAGG - Intronic
1104097021 12:125567228-125567250 CAAATTGAGAAAAGGGCAGAGGG - Intronic
1104223542 12:126809731-126809753 CACATTGAACAGAAGGAAGTAGG + Intergenic
1104628359 12:130378148-130378170 CTGCTTGCAAAGAGGCAAGATGG - Intergenic
1106142064 13:27019882-27019904 CAGAGAGAAAAGAGGAAAGTTGG + Intergenic
1106202840 13:27556227-27556249 CAGAATAAAGAGAGGTAAGATGG - Exonic
1106402028 13:29440644-29440666 CAGATGGTCGAGAGGGAAGATGG - Intronic
1106944177 13:34807605-34807627 CAGAATGAAAAGGTAGAAGAAGG - Intergenic
1107077693 13:36340967-36340989 CATATTGAAAGATGGGAAGATGG + Intronic
1107318400 13:39159411-39159433 CAGCTGGGAAAGAGGGAAGCTGG - Intergenic
1107571443 13:41663309-41663331 CAGATGGAAAAGAGGAATGAGGG - Intronic
1107667003 13:42700765-42700787 AAGAAGGAAAAGAGGAAAGAAGG + Intergenic
1107825287 13:44323961-44323983 CAGCTTGCAAAGAGGGAAGAGGG - Intergenic
1108288106 13:48928683-48928705 CACTTTGAAAAGGGGGAAGGAGG + Intergenic
1108323453 13:49307752-49307774 AAGATTGAAAAGATTGAAGATGG - Intergenic
1108758825 13:53537716-53537738 CAGAAAGAAAAGAGAGAAGGGGG - Intergenic
1108771136 13:53701251-53701273 CACATTGAAAAGAATGAAGTTGG + Intergenic
1108775350 13:53759099-53759121 AAGAATGAAAAGAGGGAAGAAGG - Intergenic
1109173986 13:59132621-59132643 CAGATTGCAAAGCAGGAAGGTGG - Intergenic
1109576879 13:64271214-64271236 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic
1110092279 13:71468013-71468035 TAGATTGAAAAGGGGGATGTGGG - Intronic
1110512936 13:76374447-76374469 CAGAATGCAAAAAGGGAAGTTGG - Intergenic
1110931852 13:81229044-81229066 CACATTCAAAGGAGGGGAGAGGG + Intergenic
1111037588 13:82698699-82698721 CAGAGAGAAAAGAGAGAAAAAGG + Intergenic
1111119606 13:83829603-83829625 CAGACTGTTAAGAGGGCAGAAGG + Intergenic
1111550055 13:89796734-89796756 CAGATAGAAAAGAGATAATAAGG - Intergenic
1111726018 13:92010174-92010196 CAGATGTAAAACAGGAAAGAAGG - Intronic
1112361327 13:98721389-98721411 CAGCTAGAAAACAGGGCAGAAGG + Intronic
1113047994 13:106176640-106176662 CAGATTAAAAAAAGGAGAGAAGG + Intergenic
1113091138 13:106618442-106618464 CAGATTAAAAGGAGTGAAAAAGG - Intergenic
1113110144 13:106814205-106814227 CAGAAAGAAAAGAGGGAGGGAGG + Intergenic
1114004746 14:18300410-18300432 TAAATTGGCAAGAGGGAAGAAGG + Intergenic
1115243562 14:31272680-31272702 CAGGTGGCAAAGAGGGAAGGAGG - Intergenic
1115948268 14:38689977-38689999 TAGATGGAAAATAGGAAAGAAGG - Intergenic
1116375828 14:44199524-44199546 AAGAAAGAAAAAAGGGAAGAAGG + Intergenic
1116743659 14:48790524-48790546 AAGGATGAAAGGAGGGAAGAAGG + Intergenic
1117503402 14:56376354-56376376 CAGATAGGAAAGTGAGAAGAAGG - Intergenic
1117799282 14:59426880-59426902 TGGATTGAAATGAGGAAAGAGGG - Intergenic
1117841267 14:59862848-59862870 AAGTTTGAGAAGAGGGGAGAAGG - Intronic
1117976351 14:61300821-61300843 AAGGTTGACAAAAGGGAAGATGG - Intronic
1118159920 14:63277836-63277858 CAGAGAGAAAAGAGAGAAGTGGG + Intronic
1119326525 14:73762795-73762817 CAGTTTGTAAAGAGGGTTGAGGG - Intronic
1119552667 14:75526224-75526246 CAGAGTGAAGAGAGGTAAGGTGG - Intronic
1120396331 14:83971439-83971461 TAGGTTGAAAAGAAGGAGGAAGG + Intergenic
1120426412 14:84353213-84353235 CCCATTAAAAAGTGGGAAGAAGG + Intergenic
1120721237 14:87891622-87891644 GAGAGACAAAAGAGGGAAGAAGG + Intronic
1121113195 14:91326512-91326534 CCGATTAAAAAGGGTGAAGATGG - Intronic
1121185580 14:91964875-91964897 CAGATTGCAGAGGGGGAAGAGGG - Intergenic
1121230681 14:92355322-92355344 GAGATTGGGAAGAGGGCAGATGG + Intronic
1121262628 14:92577486-92577508 CAAAGTGAAAACAGAGAAGATGG - Intronic
1121492271 14:94369089-94369111 CAGGTAGGAGAGAGGGAAGAGGG + Intergenic
1122029360 14:98901341-98901363 CAGACATAGAAGAGGGAAGAGGG + Intergenic
1122398679 14:101453705-101453727 CAGGTTGAAAAGACACAAGATGG + Intergenic
1124442135 15:29693736-29693758 CAGAAGGAAAAGAGAGAAAAGGG + Intergenic
1124602938 15:31149834-31149856 CAGAATGTCAAGATGGAAGAGGG - Intronic
1124815342 15:32985357-32985379 CATATTTAAAAGATGGAAGGAGG - Intronic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1125481855 15:40086655-40086677 CAGAGAGAAAGGAGGGAACAAGG + Intergenic
1125741196 15:41966083-41966105 CAGAATGAAAAGTGGACAGAAGG - Intronic
1126300904 15:47195192-47195214 CAGAATAAAAAGAGGAAAGATGG + Intronic
1126401486 15:48275860-48275882 GAGATTCAAATGAGGGAATAAGG + Intronic
1126497426 15:49307442-49307464 CAGGTTGATTAGAGGGGAGAGGG + Intronic
1126662753 15:51048555-51048577 CTCTTTGAAAAAAGGGAAGAAGG - Intergenic
1126907542 15:53384197-53384219 GAGGTTGAAGAGAGGAAAGAAGG - Intergenic
1128574969 15:68767552-68767574 CTGATTGAAAAGAGGCATGAGGG - Intergenic
1128575590 15:68772333-68772355 CAGATTCAGTGGAGGGAAGATGG - Intergenic
1128919058 15:71593980-71594002 CTGATGAGAAAGAGGGAAGAGGG + Intronic
1129185929 15:73906469-73906491 CAGTTTGGAAAGAAGGATGAGGG + Intergenic
1129452747 15:75659915-75659937 CAGAAAGAAAAGAGAGAGGAGGG - Exonic
1129698482 15:77754194-77754216 AGGATGGAAAAGAGGGAAGAAGG + Intronic
1129743317 15:78000837-78000859 TAGATTGAAGAGAGGGAGGGAGG - Intronic
1131611712 15:93971249-93971271 GGGTTTGAAAAAAGGGAAGAAGG + Intergenic
1133158099 16:3889942-3889964 CAGACAGGAAAGAAGGAAGAAGG - Intergenic
1133244166 16:4436302-4436324 AAGATTGAAAAGATGGAGGCTGG + Intronic
1133433136 16:5755922-5755944 CATAATGAAGAGAGGGAAGTAGG + Intergenic
1133518648 16:6534718-6534740 CAGAATGCAAAGAGGGAGAAGGG + Intronic
1134258884 16:12634550-12634572 AAGATGGGAAAGAGGGAAGAGGG + Intergenic
1134308548 16:13055676-13055698 CAGAGTGCTATGAGGGAAGAGGG - Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1135640251 16:24113556-24113578 AAGAATGAAAAGAGAGAGGAAGG - Intronic
1135945798 16:26863854-26863876 CAGATTGGAAACAGGCAAAAAGG + Intergenic
1137494079 16:48956177-48956199 CAGATTAAAAAAATGGAAGAGGG + Intergenic
1138486684 16:57349779-57349801 AAGAAAGAAAGGAGGGAAGAAGG - Intergenic
1139345311 16:66299377-66299399 CAGGCAGAAAACAGGGAAGAAGG - Intergenic
1139412649 16:66776676-66776698 TAGATTGAACAGAGGGAGAATGG + Intronic
1139466591 16:67157235-67157257 TGGATTGAGAAGAGGGAGGAGGG - Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140498557 16:75411732-75411754 TGGATTGAAAAGAGGATAGATGG + Intronic
1141549800 16:84798300-84798322 CAGATGGGAAAGAGAGAAGTAGG + Intergenic
1143520446 17:7441363-7441385 GAGAATGAAAGGAAGGAAGAGGG - Intronic
1143590114 17:7880200-7880222 CAGACAGAAGAGAGGGGAGAGGG + Intronic
1143761866 17:9110572-9110594 TAGATAGAAAAGAGGCAGGAGGG - Intronic
1144083064 17:11782355-11782377 AAGATCAAAGAGAGGGAAGATGG - Intronic
1144772094 17:17765657-17765679 CCGTTTCACAAGAGGGAAGACGG + Intronic
1145095756 17:20024646-20024668 GAGATTGAAAGGTGGGAGGAAGG + Intronic
1145115210 17:20203908-20203930 CAGATGGCAGAGAAGGAAGAAGG - Intronic
1145301709 17:21645571-21645593 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1145328017 17:21848132-21848154 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1145348601 17:22057753-22057775 CAGAGTGTAAAGGGGGCAGAAGG - Intergenic
1145694822 17:26779516-26779538 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1147036455 17:37685181-37685203 TAGATGGAAGAGAGGGAGGATGG - Intergenic
1147451571 17:40508559-40508581 CTGATTGACATGAGAGAAGATGG - Intergenic
1148024627 17:44578073-44578095 GAGATTGAAAAGATTGAAGGAGG - Intergenic
1148660617 17:49328645-49328667 CAGAATGCAAAGGGGGAAGCAGG - Intronic
1148922066 17:51046389-51046411 CAGATTGAAACAATGGAAAATGG - Intronic
1148997475 17:51723801-51723823 CAGATGGAAAAGAGGGCAGAGGG - Intronic
1149187313 17:54014783-54014805 AAGATGGAAAAGATGGAAGATGG + Intergenic
1149557272 17:57582717-57582739 CTGATTGACATCAGGGAAGATGG - Intronic
1150727936 17:67666652-67666674 GAGATTGAGAAGAGGCAGGAGGG + Intronic
1151169907 17:72237305-72237327 CAGAATCAAAAGAGAGAAGGAGG + Intergenic
1151365673 17:73614656-73614678 AAGATTGAAAAGGGGGAGGGAGG + Intronic
1151366637 17:73621779-73621801 AAGATTGAAAAAAGTGAACAGGG + Intronic
1151384022 17:73744256-73744278 CAGAGTGAAAGGCAGGAAGAGGG - Intergenic
1151531963 17:74712403-74712425 GACTTTGAAAGGAGGGAAGAGGG - Intronic
1152003216 17:77660286-77660308 AAGAAGGAAAGGAGGGAAGAAGG - Intergenic
1152137561 17:78513730-78513752 CAGATTAAATAGAGGAAAGCCGG - Intronic
1203192637 17_KI270729v1_random:204353-204375 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1203202004 17_KI270730v1_random:3788-3810 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1153927245 18:9844710-9844732 CACATTGAAAAGAGGTCAGTAGG + Intronic
1154050764 18:10954822-10954844 CAGAGAGAAATGAGAGAAGAAGG - Intronic
1154413728 18:14160734-14160756 CAGATGCAAAAGAATGAAGATGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155724433 18:29062004-29062026 CAGAAAGAGAAGAGTGAAGAAGG - Intergenic
1155743826 18:29324846-29324868 GAGTTTGAAAAGTGGGAAAATGG - Intergenic
1155943921 18:31826578-31826600 GAGATTTCAGAGAGGGAAGAGGG - Intergenic
1156052022 18:32948597-32948619 CAGATTGCAAAGAAGTAAAATGG - Intronic
1156191886 18:34729739-34729761 CACAAAGAAAAGATGGAAGATGG + Intronic
1156729480 18:40173983-40174005 CAGTTTGGAAAGAGGGGGGAAGG - Intergenic
1156824835 18:41418568-41418590 CAGGAATAAAAGAGGGAAGAAGG - Intergenic
1156955316 18:42955836-42955858 GAGCTTGGAAAGAGGGAACAAGG - Intronic
1156999063 18:43502629-43502651 CAGATTGAAAATAGTTAAAATGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157534475 18:48448240-48448262 CAGATTGGCAAGGGGGAAGTCGG - Intergenic
1158038980 18:53069809-53069831 TAGATTGTAAATAGGGAAGGGGG - Intronic
1158047878 18:53178093-53178115 CTGATTGAACTGAGTGAAGAAGG - Intronic
1158199772 18:54926629-54926651 CAGATGGAAAAGTTGGAAAATGG + Intronic
1158845260 18:61435361-61435383 CACATTGAAAGGAGGAAAAAGGG - Intronic
1160216318 18:76935633-76935655 GAGCTTGCACAGAGGGAAGACGG - Intronic
1160293531 18:77617097-77617119 CACTCTGAAAAGTGGGAAGAAGG - Intergenic
1161885628 19:6993002-6993024 AAGATTCAAAAGATAGAAGAGGG - Intergenic
1162028770 19:7908576-7908598 CAGGAGGAAAAGAGGGGAGAGGG + Intronic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1162803424 19:13123552-13123574 AAGAATGAAAAGAATGAAGAAGG + Intronic
1164490220 19:28704340-28704362 GTGATAGAAAAGAGGGAAAAAGG - Intergenic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1165186579 19:34027556-34027578 CAGATGGGAAAGAGAGGAGACGG + Intergenic
1167435215 19:49475062-49475084 GAGATGGACAGGAGGGAAGATGG + Intronic
1167780601 19:51596365-51596387 CAGAATGAGAAGAGGGGTGATGG + Intergenic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1167867152 19:52337497-52337519 GAGAAGGAATAGAGGGAAGAGGG + Intronic
1167889633 19:52528924-52528946 GAGAAGGAATAGAGGGAAGAAGG + Intronic
1167903111 19:52637103-52637125 GAGAAGGAATAGAGGGAAGAAGG - Intronic
1167964361 19:53131672-53131694 GAGAAAGAATAGAGGGAAGACGG - Intronic
1168020709 19:53606832-53606854 CAGATGGGGAAGAGGGAAGAGGG - Intergenic
1168433798 19:56302294-56302316 GAGGGAGAAAAGAGGGAAGAAGG - Intronic
925881715 2:8358146-8358168 GAGAGAGAAAAAAGGGAAGAGGG + Intergenic
926001856 2:9339733-9339755 CAGATAGTGAAGAAGGAAGAGGG - Intronic
926119900 2:10236218-10236240 AGGATGGAGAAGAGGGAAGAGGG - Intergenic
926411232 2:12604784-12604806 CAGATGGAAGTGTGGGAAGAGGG + Intergenic
926418521 2:12674688-12674710 CTAATTGAAAAGAGGGCAGGTGG - Intergenic
926534358 2:14092511-14092533 CGGGAAGAAAAGAGGGAAGATGG + Intergenic
926576658 2:14589906-14589928 CAGACTGAAAAGTTGGAACAGGG + Intergenic
926828383 2:16932772-16932794 CAGTCAGAAAAGGGGGAAGAGGG - Intergenic
926944109 2:18168839-18168861 CACATTGGATAGAGGCAAGAAGG + Intronic
927503765 2:23599951-23599973 CAGAATGAAAAGGGGGATGGGGG - Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927703122 2:25280468-25280490 GAGAGTGAGAACAGGGAAGAAGG - Intronic
928498610 2:31862984-31863006 AAGAAAGAAAAGAGGGAAAAAGG + Intergenic
929342202 2:40834242-40834264 CAGATGGGAAGGAGGGAGGAAGG - Intergenic
929465987 2:42144422-42144444 CAGATTCTGAACAGGGAAGAAGG + Intergenic
929620585 2:43350232-43350254 CAGATTGAAAGGGGGTAAAAGGG + Intronic
929647169 2:43638831-43638853 CAGAATGAAATGAGGGAATCAGG + Intronic
930494793 2:52127493-52127515 CAGATGGCAAAGGGGGAAGAAGG - Intergenic
930527920 2:52554303-52554325 CAAATTCAAAAGTGGTAAGAAGG + Intergenic
932034426 2:68227922-68227944 CAGATTGGAAAGAAGAAAAACGG - Intronic
932865996 2:75343813-75343835 CAGATTCAAAAGATGGAGCAAGG - Intergenic
932887690 2:75561706-75561728 AAGCTTGGACAGAGGGAAGACGG + Intronic
933022255 2:77208488-77208510 CTGAGTGAGAAAAGGGAAGAAGG + Intronic
933129021 2:78649770-78649792 CAGATTCAGAAGAGAGGAGAAGG - Intergenic
933192973 2:79357527-79357549 CAGATAGAAAAGAGAGAGAATGG + Intronic
933212148 2:79582722-79582744 GGCATTGAAAAGAGGGAAGAAGG - Intronic
933427816 2:82135494-82135516 AAGATGGAAGAGAGGGAACAGGG - Intergenic
934033087 2:88065280-88065302 CAGAAAAAAAAGAGGGAAGGGGG - Intergenic
934042588 2:88141010-88141032 AAGAAAGAAAAGAGGGAGGAGGG - Intergenic
934108818 2:88722886-88722908 CAGATGGCAAAGGGGGAAGAAGG + Intronic
934962314 2:98687503-98687525 GAAAGTGAGAAGAGGGAAGAAGG - Intronic
935534644 2:104279883-104279905 CAGATTTGGAAGAGGAAAGAGGG - Intergenic
937474526 2:122203132-122203154 CAGTTTCAATAGAGGGAAGGGGG + Intergenic
937579498 2:123467106-123467128 CAGATGGCAAAGAAGGAAGGAGG - Intergenic
938119617 2:128624394-128624416 GAGATTGGAAACAGGGAAAAGGG - Intergenic
939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG + Intergenic
939285098 2:140119217-140119239 TAGATTGAAAAGAAAGAAAAAGG - Intergenic
939472385 2:142640115-142640137 TAGAAAGAAAAGAAGGAAGAAGG - Intergenic
939548797 2:143588020-143588042 CTGTTTGGAAAGAAGGAAGAGGG - Intronic
939588153 2:144030615-144030637 TAGATTCAAACGAAGGAAGAAGG + Intronic
939673048 2:145037502-145037524 AAGAGAGAAAATAGGGAAGAAGG - Intergenic
939737371 2:145865353-145865375 CAGAGAGAAAAGATGGTAGAGGG - Intergenic
939893592 2:147766501-147766523 CACATTGAAAAGAGAGGACAAGG + Intergenic
940207182 2:151216090-151216112 CTGATTGAAAAGAGGCAGTAGGG + Intergenic
940502590 2:154512370-154512392 CAGATGGCAAAGTGGCAAGATGG + Intergenic
940535876 2:154943671-154943693 GAGTTTGAAATGAGGGATGAGGG - Intergenic
942396350 2:175553798-175553820 ATGAATGAAAAGTGGGAAGAAGG - Intergenic
942892081 2:181002825-181002847 CACAATAAAAAGAGGTAAGAGGG - Intronic
942944569 2:181658220-181658242 CATATTGAAAAGAAGGAGTAGGG + Intronic
943107703 2:183567166-183567188 CAGATTGAAAAGTGCTAATATGG - Intergenic
943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG + Intronic
944039568 2:195338520-195338542 GAGAAAGAAAAGAGGGAAAAAGG - Intergenic
944396757 2:199276749-199276771 CATTTTGAAAAAAGGGAAAAAGG - Intronic
945571903 2:211478739-211478761 GAGTTAGAAAAGAGGTAAGATGG - Intronic
945577624 2:211551878-211551900 AAAATGGAAAAGAGGAAAGAAGG + Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
945718833 2:213392479-213392501 CAGTTTGAAAATATGGAAGTTGG + Intronic
946598285 2:221331015-221331037 CAGATTGGAGAGTGGGAGGAAGG + Intergenic
946601512 2:221365087-221365109 TAGAGAGAAAATAGGGAAGAGGG + Intergenic
946638561 2:221757630-221757652 GTCATTCAAAAGAGGGAAGACGG + Intergenic
946963121 2:225006017-225006039 TAGAGTGGAAAGAGTGAAGATGG + Intronic
946966970 2:225046235-225046257 CAAATTTTAAAGAAGGAAGAAGG - Intergenic
947524399 2:230869557-230869579 CAGGCTGAGAACAGGGAAGATGG - Intronic
948547314 2:238742109-238742131 CAGATTCACAGGAGGGAAAATGG + Intergenic
948783435 2:240338863-240338885 CAGAAGGCGAAGAGGGAAGAGGG - Intergenic
948797383 2:240411944-240411966 CAGGTTGCCAAGAGGGAATAGGG + Intergenic
1168803522 20:659553-659575 AAGAGTCAAAAGATGGAAGATGG - Intronic
1169176124 20:3516131-3516153 AAAATTGAAGAGAGGGAAGAAGG + Intronic
1169662286 20:7993203-7993225 AAGATTATAAAGATGGAAGAAGG - Intronic
1169752116 20:9004992-9005014 CAGATAGAAAAAAGGAATGAAGG - Intergenic
1170249328 20:14263024-14263046 CAGATTGAAAATAAAGGAGATGG + Intronic
1170905373 20:20511370-20511392 CTGATTGAAAAGCGGCAAAATGG - Intronic
1171014353 20:21526292-21526314 CAGAATAAAAATTGGGAAGATGG - Intergenic
1171049891 20:21847469-21847491 CAGATGGAAAAGAGTGAAGTTGG + Intergenic
1171235797 20:23523669-23523691 CAAAATGCAAAGAGGGAAGAGGG + Intergenic
1171518287 20:25756954-25756976 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1171558570 20:26099252-26099274 CAGAGTGTAAAGGGGGCAGAAGG - Intergenic
1172931382 20:38588560-38588582 CCCATTGAACAGATGGAAGAGGG - Intergenic
1173173372 20:40744990-40745012 CACATTCAAAAGAGAGAACATGG + Intergenic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1174687085 20:52466358-52466380 CAGACAGAATAGAGGGAGGATGG + Intergenic
1175422480 20:58843235-58843257 CAGGGTGTAAAGAGGGAAGCTGG - Intronic
1175487488 20:59356063-59356085 CAGATGGGAGAGAGGGGAGAGGG - Intergenic
1175523564 20:59618442-59618464 CAGAGTGAGACCAGGGAAGAGGG + Intronic
1176242581 20:64081898-64081920 CAGACAGGCAAGAGGGAAGAGGG - Intronic
1176652447 21:9563368-9563390 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1176859296 21:13997521-13997543 CAGATGCAAAAGAATGAAGATGG - Intergenic
1176960221 21:15151142-15151164 AAGATTGAGAAGAAAGAAGAAGG - Intergenic
1178125845 21:29514866-29514888 CACATTCAAAAGAAGGAAAATGG - Intronic
1178234193 21:30822573-30822595 TAGATTGAAAAGAGTGCAGAAGG + Intergenic
1179011873 21:37562732-37562754 GAGATGCAAAAAAGGGAAGAAGG - Intergenic
1180429260 22:15231200-15231222 TAAATTGGCAAGAGGGAAGAAGG + Intergenic
1180737364 22:18027399-18027421 AAGATAGCAAAGAGGGCAGAAGG + Intergenic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181642991 22:24214582-24214604 AAGATGGAAAAGAGAGAAGGAGG + Intergenic
1182536742 22:31009368-31009390 CAGTATGGAAATAGGGAAGAAGG + Intergenic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1183153237 22:36054037-36054059 GAGACTGAAAATAGGAAAGAAGG - Intergenic
1183214939 22:36473533-36473555 CAGAAAGAAAAGAGGAAGGAAGG + Intronic
1183719271 22:39552897-39552919 CAGAGAGAAAAGAGTGGAGAGGG - Intergenic
1184137244 22:42556471-42556493 GAGAATGAATAGGGGGAAGAAGG - Intronic
949743189 3:7260116-7260138 AACATTGAAAAGTGGGCAGAGGG - Intronic
951357856 3:21690985-21691007 CAGATTTTAATGAGGGAAAAAGG - Intronic
951363855 3:21756603-21756625 TAGATTGAAAAAGGAGAAGAGGG + Intronic
951482223 3:23173332-23173354 CAAATTAAAAAGAGGTAAGAAGG + Intergenic
951870931 3:27361377-27361399 AATATTGAAAAGAGGAAAAAAGG + Intronic
952112566 3:30140954-30140976 TTGATTCACAAGAGGGAAGAAGG - Intergenic
952361589 3:32635689-32635711 AAGATGTAAAAGAGGGCAGACGG - Intergenic
953108265 3:39907152-39907174 CAGATGGAGAGGAGGGAACATGG - Intronic
954587847 3:51752193-51752215 CAGATGGCAAAGGGGGAAGAAGG + Intergenic
954886043 3:53874815-53874837 CAGAATGAATGGATGGAAGAAGG + Intronic
955316127 3:57940672-57940694 CAGATTAAAAAGGGGGAAGAAGG + Intergenic
955687602 3:61562254-61562276 CACATCGAAAAGAGGAAAGCAGG - Exonic
956181674 3:66523470-66523492 CATATTGTAAAGAGGGACCATGG + Intergenic
956445638 3:69323104-69323126 GAAAATGAAATGAGGGAAGAGGG + Intronic
956647350 3:71469289-71469311 CAGATTTCAAAGAAGGAAAAAGG + Intronic
956838782 3:73117725-73117747 CAGAAAGAAAGGAGGGAAGAGGG - Intergenic
956884866 3:73548925-73548947 CAGCTGGAAAAGAGAGAAAATGG + Intronic
957837716 3:85619377-85619399 CAGAATGAAAGGGGGAAAGAAGG + Intronic
958008103 3:87839497-87839519 CTGAGTGAAAAGAGCGAAGTAGG - Intergenic
959442813 3:106399523-106399545 CAGATAGCAAAGATGGAACAAGG - Intergenic
959925681 3:111919228-111919250 AAGAAAGAAAAAAGGGAAGAGGG - Intronic
960591409 3:119369271-119369293 CAGTTGGCAAAGAGGGATGAGGG + Intronic
962125896 3:132617401-132617423 CAAATTGAAAAGATGAAGGAAGG - Intronic
962892665 3:139686169-139686191 CAGGAGGAAAAGTGGGAAGAAGG - Intergenic
963008623 3:140749413-140749435 GAGAAAGAAAAGAGGAAAGATGG + Intergenic
963311828 3:143718222-143718244 AAGATTGCAAAGAGGAAAAAGGG - Intronic
963547287 3:146676159-146676181 CAGATTCAACAGAGGGACTATGG + Intergenic
963764562 3:149320805-149320827 AATATAGAAAAGTGGGAAGAAGG + Exonic
964032112 3:152150780-152150802 CAGATTGCAAGGAGGAAGGAAGG - Intergenic
964130249 3:153279009-153279031 CAGTTTCAAGAGAGGGAGGAGGG - Intergenic
964209780 3:154214068-154214090 CACATGCAAAAGAGGGAAGGTGG + Intronic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
964611693 3:158622209-158622231 CAGATGGCAAAGGGGGAAGGAGG + Intergenic
964786159 3:160399059-160399081 CAGCTTCAAAACAGGAAAGATGG + Intronic
965011867 3:163103848-163103870 CAGATGGAAAAATGGAAAGAAGG + Intergenic
966706048 3:182915028-182915050 CAGGTTATAAAGAGTGAAGAAGG + Intronic
967240687 3:187436413-187436435 CAGAGTGAAAAAAGAGAAGGAGG - Intergenic
968294285 3:197561884-197561906 CAGATGGCAAAGGGGGAAGGAGG - Intronic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
968840934 4:3005355-3005377 GAGGTTAAAGAGAGGGAAGATGG + Intronic
968996943 4:3951744-3951766 CACATGGAAAGGAGGGCAGAGGG + Intergenic
969727216 4:8927672-8927694 CAGATGGCAAAGGGGGAAGGAGG - Intergenic
970164409 4:13221364-13221386 CAAATGTAAAAGAGGGAAGAGGG + Intergenic
970313197 4:14804390-14804412 CTGATTGTAAAGAGGGCAAAAGG + Intergenic
971218339 4:24682412-24682434 CAGAATGAAAAGAGAGAGGGAGG - Intergenic
971348178 4:25831013-25831035 CAGATAGAATAGAAAGAAGAAGG + Intronic
971720796 4:30243519-30243541 CAGAAGGAAAAGAGCAAAGAAGG + Intergenic
971734383 4:30427450-30427472 CAGAAGGCAAAGAGGGAACAAGG + Intergenic
971745759 4:30578061-30578083 AAGAGTGAAATGAGGGAGGAAGG - Intergenic
971820518 4:31548137-31548159 CAGTTTAAAAAGAGGAAATAGGG - Intergenic
971825738 4:31620190-31620212 CAGAAGGAAAAAAGGAAAGAAGG - Intergenic
972016767 4:34256496-34256518 CACATTATAAAGAGGGAAGATGG + Intergenic
972316819 4:37934478-37934500 CAGATTGGAAGGAGGGAGAAAGG + Intronic
972706151 4:41544973-41544995 CAGAATGGAAACAGGAAAGATGG - Intronic
974015671 4:56646728-56646750 CAGATAGTAAAATGGGAAGATGG + Intergenic
974554091 4:63420814-63420836 TAGAATGAAAGGAGGAAAGAAGG - Intergenic
975097987 4:70479621-70479643 GAGATTGAATACAGGGAAGAGGG + Intronic
975228098 4:71897928-71897950 CAGATAGGAAGGATGGAAGATGG - Intergenic
976316471 4:83664178-83664200 GGGATTGATAAAAGGGAAGATGG - Intergenic
976636638 4:87293001-87293023 CAGTTGGAAAAGAGGCAAGCAGG + Intergenic
976776950 4:88717632-88717654 GAGAATGAAAACAGTGAAGAAGG - Intergenic
976842022 4:89443063-89443085 GAGATTAAAAAAAGAGAAGAAGG + Intergenic
977099672 4:92795061-92795083 CACATTGAAAAGGCAGAAGAGGG + Intronic
977348912 4:95855694-95855716 AAGATAGAAAAGAAGAAAGAAGG + Intergenic
978009559 4:103663034-103663056 CAGAAAGTAAAGAGGGAAGGTGG + Intronic
978905648 4:114002318-114002340 CAAATGGAAATGAAGGAAGAAGG - Intergenic
979387046 4:120079135-120079157 GAAATTGAAAACAAGGAAGAAGG + Intergenic
981415265 4:144485546-144485568 CAGATTGAAAAGCTAGCAGAAGG + Intergenic
982063391 4:151627061-151627083 TAGAAGGAAAAGATGGAAGAAGG + Intronic
982194783 4:152900032-152900054 CAGATAGCAGAGAGAGAAGATGG + Intronic
982515390 4:156340863-156340885 CAGAATGTAAAGAAGGAAGCAGG + Intergenic
982829335 4:160041790-160041812 CAGGATGAAAAGATGGCAGAAGG + Intergenic
983279964 4:165667953-165667975 CAGATTCACCAGAGGGAAAAGGG + Intergenic
983408839 4:167370298-167370320 GAGACTGAAAAGTAGGAAGAAGG + Intergenic
983445343 4:167843449-167843471 AAGATTGAAAAGAAGAAATAAGG - Intergenic
983552572 4:169032490-169032512 AAGAAGGAACAGAGGGAAGAAGG - Intergenic
983568527 4:169179643-169179665 CAGCTTGAAAACAGAAAAGAAGG + Intronic
983810918 4:172061233-172061255 CAGATTGAAAGGAGGTGAAAAGG - Intronic
983907745 4:173202518-173202540 GAGACAGAAAAGAGTGAAGAGGG - Intronic
983977379 4:173952165-173952187 AAGATTGAAAAGATGACAGAAGG + Intergenic
984570271 4:181383658-181383680 CAGATTGTAAAGAGCAAGGATGG - Intergenic
985208468 4:187566396-187566418 CTTATTGAAAGGAGGAAAGAAGG - Intergenic
985234362 4:187856725-187856747 CAGATTGCAATGAGGGCTGAGGG + Intergenic
985326656 4:188778135-188778157 CATTTTGCAAAGAGGGAACATGG + Intergenic
986044325 5:4022827-4022849 CAGAAAGAAAATAGGGAAGATGG - Intergenic
986263127 5:6166569-6166591 TGGGTTGAAAAGAGGGATGAGGG - Intergenic
987155958 5:15089904-15089926 CATAGAGAAAAGAGGAAAGAAGG + Intergenic
987229497 5:15878817-15878839 CAGCTTGAAAAGTGAGAAGGAGG - Intronic
987562145 5:19538352-19538374 TAGATTGCACAGAGGGAAGATGG + Intronic
987811685 5:22845007-22845029 CATACTGAAAAGGGGGAAGAAGG - Intronic
989230332 5:39078478-39078500 CTGATTGACATTAGGGAAGATGG - Intergenic
989507853 5:42247988-42248010 CAGAAGGAAGAGAGAGAAGAGGG + Intergenic
990211064 5:53481774-53481796 AACATTAAAAAGGGGGAAGAGGG + Intronic
990368758 5:55095662-55095684 CAGGTTGAGTAGAGGGTAGAGGG - Intergenic
991226165 5:64275659-64275681 CAGGGAGAAAAGAGAGAAGAAGG - Intronic
991404006 5:66284079-66284101 CAGATTGAAAGGAGTGCAGGAGG + Intergenic
991664315 5:68982586-68982608 CTGATTGAAATAATGGAAGAAGG + Intergenic
992161837 5:74011904-74011926 CAGAGTGGAAAAAGGGAAGCTGG + Intergenic
992376301 5:76191162-76191184 CAGAAGGAAGAGAGAGAAGAGGG + Intronic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
993593686 5:89826673-89826695 CAGAGAGAAAAGCTGGAAGATGG + Intergenic
994247424 5:97495568-97495590 CTGATTCCAAAGAAGGAAGAAGG + Intergenic
995096653 5:108243640-108243662 CAGTTTGACAAAACGGAAGAAGG - Intronic
995163460 5:109009332-109009354 CCTATTAAAAAGATGGAAGAGGG - Intronic
995183469 5:109249688-109249710 CAGCTTGAAGAGAGGGACGGGGG + Intergenic
996139664 5:119890712-119890734 AAGAATGAACAGAGGGAATATGG - Intergenic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
996578495 5:125002992-125003014 CAGAATGTCAAGAGAGAAGAGGG + Intergenic
996686098 5:126282639-126282661 CAGATTGAAAAGAGGGACCTTGG + Intergenic
996744554 5:126835229-126835251 AAGGTTCATAAGAGGGAAGATGG + Intronic
996930030 5:128875141-128875163 CAGAAGGCAAAGAGGGAAGCCGG - Intronic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997174514 5:131760855-131760877 CAGGAGGGAAAGAGGGAAGAAGG + Intronic
997184763 5:131870851-131870873 CAAATAGAAAAGGGGCAAGAGGG - Intronic
997413531 5:133708068-133708090 TAGAAAGAAAAGAGGGAAGGAGG + Intergenic
997455152 5:134011299-134011321 CCCATTAAAAAGAGGGCAGAGGG - Intergenic
997665319 5:135625718-135625740 CAGGTAGAACAGGGGGAAGAAGG + Intergenic
997771921 5:136563027-136563049 CTGCTTGAAGATAGGGAAGATGG + Intergenic
999023774 5:148201573-148201595 TAGAATGGAAAGAGGGAGGAAGG + Intergenic
999292704 5:150437211-150437233 AAGAAAGAAAAGAAGGAAGAAGG + Intergenic
999475907 5:151898712-151898734 CAGATTGAAGACAGGGAGGTGGG + Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1002031066 5:176430899-176430921 CGGATGGCAAAGAGGGAAGCAGG + Intergenic
1002653038 5:180717777-180717799 CTGGTAGAAAAGAGGAAAGAGGG - Intergenic
1003231391 6:4256832-4256854 GAGTTTGAACAGAGGAAAGACGG + Intergenic
1003481830 6:6541733-6541755 AAGACGGGAAAGAGGGAAGAGGG - Intergenic
1004790386 6:19019745-19019767 AAGACAGAAAAGAGGGAGGAAGG + Intergenic
1005065032 6:21809345-21809367 CAGATTTAATAGAGTGCAGAGGG - Intergenic
1006100232 6:31681801-31681823 CAGGATGATAAGGGGGAAGATGG + Intronic
1006324023 6:33339668-33339690 CAGACTGAAAATGGGGATGAGGG + Intergenic
1006789351 6:36689019-36689041 CAAATTAAAAAGTGGTAAGAGGG + Intergenic
1006883609 6:37360989-37361011 CAGATTGAAAGGAGTGAGGAAGG - Intronic
1006920751 6:37625666-37625688 CAGAAAGAAGGGAGGGAAGAGGG - Intergenic
1007330657 6:41104940-41104962 GAAAATGAAAAGAAGGAAGAAGG + Intergenic
1007386615 6:41524368-41524390 AGGAGTGAAAAGGGGGAAGAGGG + Intergenic
1007773291 6:44208330-44208352 CAAATTGAAAAGAGGTATAAAGG + Intergenic
1008457743 6:51730925-51730947 GAGGTTGAAGGGAGGGAAGAGGG + Intronic
1008781828 6:55116505-55116527 AAGAAAGGAAAGAGGGAAGAAGG + Intronic
1009567779 6:65334761-65334783 CACAATAAAAGGAGGGAAGAAGG - Intronic
1011596514 6:89021728-89021750 CAAGCTGAAAAGAGGCAAGAAGG + Intergenic
1011716029 6:90105998-90106020 GAGCTTCAGAAGAGGGAAGAAGG + Intronic
1011939620 6:92826615-92826637 CAGATGGCAAAGGGGGAAGAAGG - Intergenic
1012494280 6:99817222-99817244 CAGCATGGAAAGAGGGAAAAAGG - Intergenic
1014299027 6:119657301-119657323 TTGATTGAAAAGGGGGAAAATGG - Intergenic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1015531833 6:134228421-134228443 AACATTGAAAAAAGGTAAGAGGG + Intronic
1015623505 6:135156787-135156809 AAGATAGAAAAGAGGGTAGCTGG - Intergenic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1016053356 6:139553249-139553271 CAGCTTGAGAAAAGGAAAGAGGG + Intergenic
1016091524 6:139985028-139985050 CAGAAAGAAAAGAGGAAAGCTGG + Intergenic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1016938445 6:149465814-149465836 AAGCTGAAAAAGAGGGAAGATGG + Intronic
1016944272 6:149514192-149514214 CATAGTGAAAAGAGGGAAGTTGG - Intronic
1017161841 6:151372664-151372686 AAGATAGAAAAGAGGGAAACTGG + Intronic
1017794088 6:157825268-157825290 CCGTTTGAAAAAAGAGAAGACGG + Intronic
1017807350 6:157957125-157957147 CATATAGCAAAGAGGGAAAAGGG - Intergenic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018238888 6:161753420-161753442 CAGGTTGGAAAGAGAGAAGAAGG + Intronic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018650415 6:165987820-165987842 CAGATGGAAAGGAGGGAAGGAGG - Intergenic
1019127938 6:169853701-169853723 CAGAATGCAAAAAGGGGAGAAGG - Intergenic
1019746036 7:2700845-2700867 AGGACTGAAATGAGGGAAGAGGG + Intronic
1019804208 7:3111018-3111040 CAGAGTGAAAAGAGCCCAGATGG + Intergenic
1019952837 7:4387729-4387751 CAGATTGAACAGAGGGCTAAAGG + Intergenic
1020712257 7:11622692-11622714 CAGGTTGATAAGAGAGAATAAGG - Intronic
1021432496 7:20576457-20576479 CAGGTTGAAAAAATGGAGGAAGG - Intergenic
1021489672 7:21205432-21205454 CAGATTGAGCAGAGGCCAGAGGG + Intergenic
1022036691 7:26541410-26541432 CTGATTGAAAAGAGGGGAAAAGG + Intergenic
1022052761 7:26694814-26694836 TAGATTAAAAAGGGGGAAAAAGG - Intronic
1022072425 7:26930255-26930277 CAGTTTGAAAAAGGAGAAGATGG - Intronic
1022340728 7:29465052-29465074 CAGAAGGAAAAAAGGCAAGAAGG - Intronic
1023627153 7:42127409-42127431 CTCATTGAGAAGAGGGAAGTGGG - Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024437364 7:49374834-49374856 CACATTGAAAGGAGAGAAGTGGG - Intergenic
1024471093 7:49769474-49769496 AGGATTGAAGAAAGGGAAGAAGG - Intergenic
1025279114 7:57614295-57614317 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1025305617 7:57851205-57851227 CAGAGTGTAAAGGGGGCAGAAGG - Intergenic
1026509161 7:71013682-71013704 CAGACAGAAAGGAGGGAGGAAGG + Intergenic
1026958159 7:74391174-74391196 CAAATTGCAAAGATGGAACATGG - Intronic
1026966642 7:74444277-74444299 CAGATAGAAAGCAGGGAATATGG + Intergenic
1027465175 7:78506258-78506280 GAGATTGGAAACAGGGAAGGAGG + Intronic
1027899519 7:84092758-84092780 CACAATTAAAGGAGGGAAGAAGG - Intronic
1028428765 7:90722142-90722164 AAAATGGAAAAGGGGGAAGAGGG - Intronic
1029008354 7:97232956-97232978 AAGAATGAGAAAAGGGAAGAGGG + Intergenic
1029330173 7:99846828-99846850 CAGTTTTGAAAGATGGAAGAAGG + Intronic
1030019131 7:105255471-105255493 CAGATGGAAAAGAAGGAAAAGGG + Intronic
1030339413 7:108359843-108359865 CAGATTTGAATGAGGCAAGAAGG - Intronic
1030345697 7:108430732-108430754 CAGACTGAAAGGAGGTAAAAGGG - Intronic
1030424441 7:109356285-109356307 CAGAAAGAAAGGAGGGAAGGAGG + Intergenic
1030485522 7:110162149-110162171 GAGATTGAAAGGTGGGAAGAGGG + Intergenic
1030639402 7:111987282-111987304 CAGAATGAAAAGGGGAAGGAAGG - Intronic
1030913719 7:115285543-115285565 CAGAGTGAAGGAAGGGAAGATGG + Intergenic
1030922577 7:115410336-115410358 GAAATTCAAAAGAGGGAAGAAGG + Intergenic
1031363131 7:120871121-120871143 GAGAAAGAAAAGAAGGAAGAGGG + Intergenic
1031907163 7:127473308-127473330 CAGAAAGAAAAAAAGGAAGAAGG + Intergenic
1031959167 7:127973461-127973483 TAGATTGAGAAGAGGTAGGAAGG + Intronic
1032728137 7:134611288-134611310 TGGATTTAACAGAGGGAAGAAGG - Intergenic
1032961682 7:137042489-137042511 GAGAGAGAGAAGAGGGAAGAGGG - Intergenic
1033735916 7:144221657-144221679 GAGGTTGAAAACAGGGAAGACGG - Intergenic
1033747135 7:144329295-144329317 GAGGTTGAAAACAGGGAAGACGG + Intergenic
1033988800 7:147258875-147258897 CAGATTGAGAAAAGGGAATGTGG - Intronic
1034847523 7:154460373-154460395 CAGAGTGAAGAGACGGAAGTGGG - Intronic
1035495991 7:159326607-159326629 CAAAGGGAAAAGGGGGAAGACGG - Intergenic
1035863250 8:3053307-3053329 CATATTGGAAAGAAAGAAGAAGG + Intronic
1035925404 8:3722540-3722562 GACATTGACAAGAGGTAAGAAGG - Intronic
1036641421 8:10586505-10586527 CAGATTGTACAGAGAGAAGTAGG + Intergenic
1036648433 8:10626225-10626247 CAGAGTGAATAGCGGGAGGATGG + Intronic
1037139962 8:15507870-15507892 CAGATGGAAAGGAGTGAAGGTGG + Intronic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1037265202 8:17051498-17051520 TAGATTTAAAAGAGGAAAGGAGG + Intronic
1038056567 8:23863907-23863929 AAAATTGAAAAGAGAGAAAAGGG - Intergenic
1038127493 8:24691000-24691022 AAGATTGAAAAGAAGAATGATGG + Intergenic
1038228417 8:25678263-25678285 GAGAAAGAAAAGAGGGGAGAGGG - Intergenic
1038303259 8:26375627-26375649 AAGGATGAGAAGAGGGAAGAAGG - Intergenic
1038774609 8:30517351-30517373 CAGAATGAAAAGAAGGATAAGGG - Intronic
1038829256 8:31038771-31038793 CATATGGAAAAGAGTGAAGTTGG - Intronic
1039397246 8:37236943-37236965 CAGATTTAAAATAGAGAAGAAGG - Intergenic
1039578851 8:38647518-38647540 CTGATTGAAAGGACGGTAGAAGG - Intergenic
1040369904 8:46759292-46759314 GGGATTGAAAGGAGGGAGGAAGG - Intergenic
1040770551 8:50970132-50970154 CAGAATGAGAAGGGGGAAGGGGG + Intergenic
1041398719 8:57418962-57418984 CAGATTAAAAACAGGGAATCTGG - Intergenic
1041574599 8:59379898-59379920 CATTTTGGAAAGAGGGAAGTTGG + Intergenic
1041796893 8:61754345-61754367 CAGAGAGGAAAGAGGGAGGAGGG - Intergenic
1042732232 8:71948778-71948800 AAGAATGAAAAGAAGGAAGGGGG + Intronic
1042736585 8:71996228-71996250 CAGCTTGACTAGAAGGAAGATGG - Intronic
1043519026 8:81024847-81024869 AAGGTAGAAAAGATGGAAGAAGG - Intronic
1043587206 8:81783294-81783316 CAGATTGATAAGAGGGTGGAAGG + Intergenic
1044357749 8:91244385-91244407 AAGAATGAAAAGAGGGAAAGAGG - Intronic
1044576676 8:93777383-93777405 CAAATTCAAAAGAGAGCAGAAGG - Intronic
1044643197 8:94407678-94407700 GAGCTTGAAAAGATTGAAGAGGG - Exonic
1044927732 8:97223809-97223831 CAGGTTTAACACAGGGAAGAGGG - Intergenic
1045200763 8:99978479-99978501 AAGAAAGAAAAGAGGGAGGAGGG - Intronic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1045499675 8:102735525-102735547 CAGAGTGACAAGAAGGAAAATGG + Intergenic
1045551440 8:103176407-103176429 TAGATTTAAAAGAAAGAAGAAGG + Intronic
1046806200 8:118481446-118481468 AAGAAGGAAAAGAGGGAGGAAGG + Intronic
1047278344 8:123423248-123423270 CAGAAAGAAAGGAGGGAAGGAGG - Intronic
1047416229 8:124666828-124666850 GAGTTTTCAAAGAGGGAAGAGGG + Intronic
1047454983 8:125000123-125000145 CAGTTTGAAAAGCAGGCAGAAGG + Intronic
1048157135 8:131967412-131967434 CAGCCTGAAAACAGGGCAGAGGG + Intronic
1048252314 8:132876947-132876969 CAGATTGCCCAGTGGGAAGAAGG + Intronic
1048680602 8:136837366-136837388 AAGAAAGAAAAGAGGGAAGAGGG - Intergenic
1049012933 8:139899662-139899684 CAGCTTGCAGAGAAGGAAGATGG - Intronic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050037897 9:1456724-1456746 CAGATTGAGATGATGGAAGCTGG + Intergenic
1050889479 9:10806188-10806210 CTGAGTGAAAAGAGGCAGGAGGG - Intergenic
1051044002 9:12851664-12851686 AAGAAGGAAAAGAGGGAAGTGGG + Intergenic
1051446578 9:17146271-17146293 AAGAGAGAAAAGAGAGAAGAAGG - Intronic
1051622966 9:19070886-19070908 CAGACTGCAGAGTGGGAAGAAGG + Intronic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1052067517 9:24040566-24040588 CACAGAGCAAAGAGGGAAGATGG - Intergenic
1052284005 9:26763786-26763808 CAGAAGGAAAAGAGAGAGGAAGG - Intergenic
1052648303 9:31267677-31267699 AAGAGAGAAAGGAGGGAAGAAGG - Intergenic
1052704573 9:31980082-31980104 AAGATGAAAAAGAGTGAAGATGG - Intergenic
1053151110 9:35743747-35743769 AAGCTTCAGAAGAGGGAAGAAGG + Intronic
1053154336 9:35765057-35765079 CAGATTGCAATGAGCCAAGATGG + Intergenic
1053621888 9:39828037-39828059 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053837821 9:42159895-42159917 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053883197 9:42616235-42616257 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1053889472 9:42678064-42678086 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054140709 9:61527310-61527332 CAGTTAGACAAGAGGAAAGAAGG - Intergenic
1054222221 9:62423708-62423730 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1054228492 9:62485464-62485486 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1055284471 9:74713498-74713520 CAGATTGAAAGGGTGGATGAGGG + Intergenic
1055291447 9:74786121-74786143 CAGATCTAAAAGAAGGAAGAAGG + Exonic
1055429479 9:76229026-76229048 GAGAAGGAAAAGAGGAAAGAAGG + Intronic
1055739028 9:79365297-79365319 CACCTTTAAAAGAGAGAAGATGG + Intergenic
1055865897 9:80813260-80813282 CAGATTTAAAACAGAGATGAAGG + Intergenic
1056075171 9:83030917-83030939 GAGAGTGAAAAGAGGGAGAAAGG - Intronic
1056566564 9:87777828-87777850 AAGATTGAAAAGAGAGGAAAAGG + Intergenic
1057517654 9:95735664-95735686 CAGAAAGAAAAGAAGGGAGATGG - Intergenic
1057762483 9:97888083-97888105 AAGAGTGACAAGAGGGAAGGAGG - Intergenic
1058843608 9:108934254-108934276 CAGATGGGCAAGAGGGCAGAGGG - Exonic
1059035198 9:110747189-110747211 CAGATTGAAAAGGTGGTAGTTGG + Intronic
1059217120 9:112574615-112574637 GAGCTTGAATGGAGGGAAGATGG - Exonic
1059360470 9:113738262-113738284 AAGAAAGAAAGGAGGGAAGAAGG - Intergenic
1059432627 9:114259201-114259223 CAGGGTCAAAAGAGGGACGAGGG + Intronic
1060466052 9:123906317-123906339 CACATTCAAAAGATAGAAGAAGG + Intronic
1061783769 9:133011389-133011411 GAAAGTGAAAAGATGGAAGATGG + Intergenic
1061840876 9:133357944-133357966 CACAGTGAAGAGAGGGATGATGG + Intronic
1203630176 Un_KI270750v1:66909-66931 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1185835462 X:3342458-3342480 AAGATTGTAAAAAGGGAAGCTGG + Intronic
1186077582 X:5897906-5897928 GAGAGAGAAAAGAGGGAAGGGGG - Intronic
1186389147 X:9141168-9141190 CACTTTGAAAAGAGGGAGGAAGG + Intronic
1187207863 X:17199895-17199917 AAGATGGAGAAGAGGGCAGAAGG + Intergenic
1187919474 X:24186772-24186794 TAGATTGCAAAGACTGAAGAAGG - Intronic
1187971913 X:24667379-24667401 GAGATAGATAAGAGGAAAGAAGG + Intronic
1188128764 X:26404008-26404030 CATATTAAAAAGAAAGAAGATGG + Intergenic
1188161144 X:26804736-26804758 AAGATAGGAAATAGGGAAGAAGG - Intergenic
1188787050 X:34359961-34359983 GAGATTGCAAAGTGGGAGGAAGG - Intergenic
1188802222 X:34546605-34546627 CAGAAGGAAAAGAGAGAAGGGGG + Intergenic
1188817059 X:34728644-34728666 CAAATTCAAAAGAGGAAAGCAGG - Intergenic
1188922530 X:35995112-35995134 CAGATTAAAAGGATGGAAGCGGG + Intergenic
1189000701 X:36941359-36941381 CAAATTCAAAAGAGGAAAGCAGG + Intergenic
1189591766 X:42520103-42520125 CAAGTTGAAGAAAGGGAAGAAGG - Intergenic
1191905524 X:66084532-66084554 TAGATTGAGAACAGGGGAGAGGG + Intergenic
1192508821 X:71709572-71709594 CAGTTTGAAAACAGTGAAAAAGG + Intergenic
1192517876 X:71771981-71772003 CAGTTTGAAAACAGTGAAAAAGG - Intergenic
1193145903 X:78075211-78075233 GAGAATGAAAAGGGGGAAGGGGG + Intronic
1193496681 X:82220831-82220853 TAGATTCAAGGGAGGGAAGATGG - Intergenic
1193792512 X:85832665-85832687 TAGATTGAGAAGAGGGCATAGGG + Intergenic
1194573546 X:95582598-95582620 CAGAGTGAAAAGACTTAAGATGG - Intergenic
1194659212 X:96610157-96610179 CAGATGCAAAAGTTGGAAGATGG + Intergenic
1194767521 X:97859140-97859162 GAGATAGAAAAGAAGGAAGAGGG + Intergenic
1194828986 X:98597186-98597208 CAGCTGGAAAAAAGGGCAGAGGG + Intergenic
1194879099 X:99227667-99227689 CAGAGAGAAAAGGGAGAAGAAGG + Intergenic
1196149348 X:112355336-112355358 CAAAAGGAAAGGAGGGAAGAAGG + Intergenic
1196540752 X:116904080-116904102 GAGGTTGAAAAGTGGGAGGAGGG + Intergenic
1197042668 X:121958333-121958355 CAGATGGCAAAGGGGGAAGGAGG - Intergenic
1197615490 X:128685933-128685955 AAGATTGGAAAGAAGGCAGAAGG + Intergenic
1197710318 X:129661656-129661678 CACAATGAGGAGAGGGAAGATGG - Intergenic
1197835737 X:130692022-130692044 CATATTGAACAAAAGGAAGAGGG - Intronic
1197882700 X:131184664-131184686 TAGATTCTAAAGCGGGAAGAAGG - Intergenic
1198425151 X:136511033-136511055 AAGTTTGAAAAGACAGAAGATGG + Exonic
1198706365 X:139452860-139452882 GAGAATGAAAAGAGAGATGATGG + Intergenic
1199671987 X:150155344-150155366 CAGGTGGAGAAGGGGGAAGATGG - Intergenic
1199770734 X:150973645-150973667 CAGAGTGAAATTGGGGAAGAGGG + Intergenic
1200154289 X:153967161-153967183 CACATTGAAAAGCTGGGAGAAGG - Intronic
1201012290 Y:9559471-9559493 CAGATTGACAAAAGAGAACAAGG - Intergenic
1201016505 Y:9608226-9608248 AAGAATTAAAAGAGTGAAGATGG + Intergenic
1201349663 Y:13025825-13025847 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic