ID: 997146832

View in Genome Browser
Species Human (GRCh38)
Location 5:131443562-131443584
Sequence AGGTTTGTGCAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 402}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997146832_997146839 25 Left 997146832 5:131443562-131443584 CCCTTCTCCTTCTGCACAAACCT 0: 1
1: 0
2: 3
3: 45
4: 402
Right 997146839 5:131443610-131443632 AGACCCAAATCCTTAAAACAAGG 0: 1
1: 0
2: 2
3: 20
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997146832 Original CRISPR AGGTTTGTGCAGAAGGAGAA GGG (reversed) Intronic
900206285 1:1433261-1433283 AGGCTTCTGCAGAAGATGAAGGG - Intergenic
900647843 1:3717147-3717169 AGGTTTGGGCAGGAGGACAGCGG - Intronic
901173398 1:7280439-7280461 AGGTTTCTGCAGAAGCAGCTTGG + Intronic
901725728 1:11240436-11240458 GGGTTTGTGCATAAGGACCAGGG + Exonic
903622047 1:24704917-24704939 CGGCTAGTTCAGAAGGAGAAAGG - Intergenic
903684445 1:25120518-25120540 CGCCTTGTGCAGAAGGAGGAGGG - Intergenic
903734332 1:25520752-25520774 AGGGTTGGGGAGAAGGGGAAAGG - Intergenic
903883091 1:26525432-26525454 AGGCTGAGGCAGAAGGAGAATGG + Intergenic
904219673 1:28956054-28956076 ATGTGTGTGCAGTAAGAGAAAGG + Intronic
904972867 1:34432774-34432796 GGGTTTGAGGAGTAGGAGAAGGG - Intergenic
906358334 1:45128786-45128808 AGGTTTGTGGAGTAGTAGCAGGG - Intronic
907088248 1:51699325-51699347 GGGTATGTGGAGAAGGAGAGGGG - Intronic
907099604 1:51817461-51817483 AGGTTTATGCAGATTGGGAAAGG - Intronic
907185686 1:52607452-52607474 AGGCTTCTGCAGCTGGAGAAGGG - Intronic
907921591 1:58919202-58919224 AGGAGTGAGCAGAAGGAGAATGG + Intergenic
908171908 1:61513213-61513235 AGGCAGGTGCAGAAGGAGAGAGG + Intergenic
908625783 1:66040208-66040230 AGGTTTGTGCATTAGGAGTTGGG - Intronic
909298664 1:73983400-73983422 AGGTCAGTGCAGAAGGGAAATGG - Intergenic
909457794 1:75869818-75869840 AGGACAGTGCAGAAGGAAAATGG + Intronic
909598587 1:77435944-77435966 AGGTCTGTGCAGATCGTGAAAGG - Intronic
910066733 1:83162458-83162480 AGGTTTACTCAGAGGGAGAAAGG - Intergenic
910898639 1:92095369-92095391 AGGGTTGGTCAGAAGGAGCAAGG - Intronic
911638714 1:100264999-100265021 AGGCTTTGGCAGTAGGAGAAGGG - Intergenic
913159437 1:116132040-116132062 AGGTTTGTGCAGGAAGAGCAGGG + Intronic
913240931 1:116828673-116828695 AGGTTTTTGCCAAAAGAGAAAGG - Intergenic
913969193 1:143401647-143401669 AGGTCATTGCAGAAGGAGAGAGG + Intergenic
914063570 1:144227246-144227268 AGGTCATTGCAGAAGGAGAGAGG + Intergenic
914115580 1:144739108-144739130 AGGTCATTGCAGAAGGAGAGAGG - Intergenic
914686483 1:149984361-149984383 AGGCTTCTGCAGAAAGAGAATGG + Intronic
915729289 1:158041765-158041787 TGGTTTGTGCGGTGGGAGAATGG + Intronic
915874784 1:159600969-159600991 GGCTGTGTGCAGAAGTAGAAAGG - Intergenic
917649813 1:177065274-177065296 AGGTTTGTGGAGGAGAAGAATGG - Intronic
917958593 1:180125167-180125189 AGGTGTGAGCAGAAGCAGAAAGG + Intergenic
919102247 1:193109008-193109030 AGGTGGGGGCAGAGGGAGAAGGG + Intergenic
919291909 1:195643581-195643603 AGGGCTGTGCAGAAGGAAAATGG - Intergenic
920034470 1:203056887-203056909 CTGTTTGGGAAGAAGGAGAAGGG + Exonic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920748918 1:208655655-208655677 ATGGGTGTGAAGAAGGAGAATGG - Intergenic
921650792 1:217675152-217675174 AGGTTTGTAGAGAAGGAGGATGG + Intronic
922987454 1:229877015-229877037 TGGTTGGGGCAGAAGCAGAATGG + Intergenic
923154670 1:231267995-231268017 AGGATTGCTCAGAAAGAGAAAGG + Intronic
924507434 1:244699076-244699098 AGGTGTGTGCACCAGTAGAAAGG - Intronic
1063517586 10:6712163-6712185 AGGAGGGTGCAGAAGGGGAAGGG + Intergenic
1064470480 10:15630192-15630214 ATGTTTGTGCAGAATGAGAATGG - Intronic
1067113613 10:43418282-43418304 TGGTTTTTGCAGGAAGAGAAGGG - Intergenic
1068408750 10:56627056-56627078 TGGTTTGTGAAGAAGCTGAATGG - Intergenic
1068417186 10:56738907-56738929 AGGTTAGAGCAAAAGAAGAAAGG + Intergenic
1068704553 10:60059595-60059617 AGCTCTGAGCAGCAGGAGAAAGG - Intronic
1070237640 10:74646244-74646266 AATTTTGTGTAGTAGGAGAATGG + Intronic
1070290875 10:75112258-75112280 AGGTTTGACTAGAAGGAGGAGGG + Intronic
1070835359 10:79444435-79444457 AGGTTTCTGCAGAAGGCGCTGGG + Intronic
1071381547 10:85068161-85068183 AGGTTTGAGGAGAGGGAGAGAGG - Intergenic
1071998071 10:91165919-91165941 AAGTTAGTGCTGAAGAAGAATGG + Intronic
1072225751 10:93367394-93367416 AGCTTTTGGCTGAAGGAGAAAGG + Intronic
1072478029 10:95782392-95782414 AGGTATGTCCAGAATGAGGAAGG + Intronic
1073222579 10:101888129-101888151 AGTTTTATGCAGTAAGAGAAGGG - Intronic
1074449493 10:113547682-113547704 AGGACTGGGCAGAAGAAGAAGGG - Intergenic
1076621590 10:131792506-131792528 AGGGGTGTGGAGAAAGAGAATGG - Intergenic
1077410314 11:2400801-2400823 AGGTTTGTGGTGAGGGAGGACGG + Intronic
1077846374 11:6029428-6029450 AGGTTTGTGCATGAAGGGAAGGG - Intergenic
1079141424 11:17812592-17812614 AGGATTGAACAGGAGGAGAATGG - Intronic
1079381179 11:19938848-19938870 ACGTTTGCCCAGAATGAGAATGG - Intronic
1081709460 11:45207640-45207662 AGTTTTATGGAGAAGGAGACTGG + Intronic
1082118753 11:48356136-48356158 AGGCTTATGCAGTAGGAGACTGG - Intergenic
1083311216 11:61784716-61784738 AGGTGTCTGCAGAAGCAGGAAGG + Intronic
1083708643 11:64533986-64534008 AGGCAGGTGCAGAAGGAGAGCGG + Intergenic
1083998592 11:66284081-66284103 AGGTTGGGGCAGATGGAGACAGG - Exonic
1084775934 11:71375527-71375549 AAATTTGCCCAGAAGGAGAAAGG + Intergenic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085637745 11:78171488-78171510 AGTTTTATGGAAAAGGAGAAAGG + Exonic
1085660833 11:78365327-78365349 AGGTCACTGCAGAAGGAGAAGGG - Intronic
1086452162 11:86927679-86927701 AGGGTAGTTCAGAAGGAGAAAGG - Intronic
1088323651 11:108579839-108579861 AGGTTTGAGGAGTAGGAAAAGGG + Intronic
1089053075 11:115562806-115562828 AAGATAGTGCAGAATGAGAAGGG + Intergenic
1089065719 11:115660485-115660507 AGATTTGTGCAGGAGGGGAGGGG - Intergenic
1089480179 11:118798314-118798336 GGGTTTGTGGAGCAGCAGAAAGG - Intergenic
1090353634 11:126124240-126124262 AGGTATGAGCAGAGGGAGAGAGG - Intergenic
1090356907 11:126146560-126146582 AGGTCTGTGCAGAGGGATGAGGG - Intergenic
1092058837 12:5531461-5531483 AGGTTTGAGAAGAAGGTAAAAGG + Intergenic
1092202186 12:6592588-6592610 AAGTTATTGGAGAAGGAGAAAGG + Intronic
1092233903 12:6793568-6793590 AGGTTTCTGAAAAAGGAGGAAGG - Intronic
1092981395 12:13798164-13798186 AGGTTACTGAGGAAGGAGAATGG - Intronic
1093887943 12:24485032-24485054 AGGTTCGGACAGATGGAGAAAGG + Intergenic
1094549578 12:31437868-31437890 AGGTTGGGGGAGCAGGAGAACGG - Intronic
1095536753 12:43257938-43257960 ATGTCTTTGCAGGAGGAGAATGG + Intergenic
1095731663 12:45512384-45512406 AGTTTGGTGCAGAAGGGGACAGG - Intergenic
1095958957 12:47821655-47821677 AGATTTCAACAGAAGGAGAAAGG - Intronic
1096238199 12:49943839-49943861 GGGTTTGTGCACCAGGGGAAGGG - Intergenic
1096885541 12:54715544-54715566 AGGTTATTGCAGCAGTAGAAAGG - Intergenic
1097427250 12:59461681-59461703 ATGTTTTGTCAGAAGGAGAAAGG + Intergenic
1098234806 12:68408232-68408254 ATGTTTGTGCACAATGAGACTGG + Intergenic
1098508100 12:71278457-71278479 AGGTTTGAGCAGACAGAAAATGG - Intronic
1098527791 12:71506298-71506320 AGGTGTGTGTTGAGGGAGAAGGG - Intronic
1098606544 12:72397558-72397580 AGGGGTGAGCACAAGGAGAATGG - Intronic
1098811719 12:75102975-75102997 AGGTTTTCACAGTAGGAGAAAGG + Intronic
1100435067 12:94563669-94563691 AGATTTGTGGATAAAGAGAATGG - Intergenic
1102188068 12:110965241-110965263 AGGTTTGTGGTGAGAGAGAAGGG - Intergenic
1102208869 12:111109717-111109739 AGGATGGTGGAGAAGGGGAAAGG + Intronic
1102545166 12:113649190-113649212 AGGATGGTGCAGAGGGACAAGGG - Intergenic
1102672692 12:114633419-114633441 AGGTTTCTGGAGAAGGTGAAAGG + Intergenic
1102757772 12:115357177-115357199 AGGTATGTTCAGAAGAAAAAGGG + Intergenic
1104533220 12:129592755-129592777 ACGTTTGTGAAGATGGAGCAAGG + Intronic
1105987103 13:25578470-25578492 GCGTTTGCGCAGAAGGAGAAAGG - Intronic
1107068440 13:36243137-36243159 AGGTTTGGGCAGAGGGAGTAGGG - Intronic
1107118591 13:36774174-36774196 AGGTATGGGAAGAAGGAGAAAGG + Intergenic
1107612209 13:42126717-42126739 AGGTGTGTGCAAAAGTAGAAAGG - Intronic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1112270070 13:97960316-97960338 ATATTTGTGGAGAGGGAGAATGG - Intronic
1112763397 13:102715399-102715421 GGGTTGGTGGGGAAGGAGAATGG + Intergenic
1113031373 13:105997398-105997420 AGGTTGGTGCAGATGCAGGAAGG - Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113307881 13:109097490-109097512 GGGTTTCTGCAGAAGAAGAAAGG - Intronic
1114440023 14:22738800-22738822 AGTTTTTTGCAGTGGGAGAAAGG + Intergenic
1114903435 14:27096222-27096244 AGGTATGTGCAGAAGCCAAATGG - Intergenic
1115344045 14:32323273-32323295 AATCTTATGCAGAAGGAGAAAGG - Intergenic
1117213755 14:53528377-53528399 AGGATTGTTTAGAAGGAAAATGG + Intergenic
1117417702 14:55512830-55512852 AGGATTTTGCAGAATTAGAATGG - Intergenic
1117678960 14:58183944-58183966 AGGTTTGTACAGAAAGTGAAGGG + Intronic
1117992979 14:61453024-61453046 TGTTTTCTGCAGAAGCAGAAAGG - Intronic
1118085792 14:62415034-62415056 AGGTTTGTGTGGAAGGGCAAAGG + Intergenic
1118505647 14:66408069-66408091 TGGTTTGTGCAGTAGTTGAATGG - Intergenic
1118693936 14:68365207-68365229 AGGCATGTGCAGAAAGAAAAAGG + Intronic
1118972127 14:70645798-70645820 AGCTTTGTGTAGAAGGAGGATGG - Intronic
1118986719 14:70761915-70761937 AGGTTTGGGAGGAGGGAGAATGG - Intronic
1119536771 14:75409213-75409235 AGGTTTCAGGAGAAGCAGAAAGG - Intergenic
1119946887 14:78704519-78704541 TGGATTGTGCAGGAGGGGAAGGG + Intronic
1122780013 14:104139565-104139587 AGGTTTGTGTGGGAGGAGGAGGG + Intronic
1123072144 14:105647117-105647139 AGGTGGGGGCAGAAGGAGCAGGG - Intergenic
1123092153 14:105746635-105746657 AGGTGGGGGCAGAAGGAGCAGGG - Intergenic
1123154108 14:106207978-106208000 GGGTGTGTGCAGGAGGGGAAGGG + Intergenic
1123671305 15:22661291-22661313 AGGTCAGTGCAGAAAGGGAAAGG + Intergenic
1124186130 15:27531104-27531126 AGGATTGTGGAGGAGGAGGAGGG + Intronic
1124323344 15:28734520-28734542 AGGTCAGTGCAGAAAGGGAAAGG + Intronic
1124696470 15:31868680-31868702 AGCTTGGTGGAGAAGGAGAGGGG - Intronic
1125122723 15:36181866-36181888 AGTTTGGTGCAGCAGGACAATGG + Intergenic
1125186880 15:36941039-36941061 GGGTTGCTGCAGAAGAAGAATGG - Intronic
1126446474 15:48751457-48751479 GGGTTTGTGAACAATGAGAAAGG + Intronic
1127715296 15:61643745-61643767 AGGTTGGTGGAGAGGCAGAAGGG + Intergenic
1127876537 15:63116484-63116506 AAGTATGGGCAGAAAGAGAAGGG - Intergenic
1127891481 15:63255583-63255605 AGGTATGTGTGGAAAGAGAATGG + Exonic
1128884190 15:71270900-71270922 AGGTTTGTCTAGAATGATAAAGG + Intronic
1128988721 15:72240855-72240877 AGGTTTGTGCAGAAAGCAATAGG + Intergenic
1129050882 15:72780928-72780950 GGGTTTGTGTAAAGGGAGAAAGG - Intronic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129595822 15:76963424-76963446 AGGTTGGTGCAAAAGAATAATGG - Intergenic
1129862179 15:78871579-78871601 AGGTTTGCGTAGGAGGATAAAGG + Intronic
1130111386 15:80968282-80968304 AGATTGCTCCAGAAGGAGAATGG - Intronic
1130159950 15:81388795-81388817 AGGTTTGTGCAGAAAGCTGATGG - Intergenic
1130241332 15:82195679-82195701 AAGTTTGAGCAGGAGGAAAATGG - Intronic
1130459091 15:84145474-84145496 AAGTTTGAGCAGGAGGAAAATGG + Intergenic
1130544345 15:84843521-84843543 AGGTTTGTACCCTAGGAGAAAGG + Intronic
1131371414 15:91885153-91885175 AGGAGGGTGCAGAAGGAGCAGGG + Intronic
1131739926 15:95377629-95377651 TGTGTTGAGCAGAAGGAGAAAGG - Intergenic
1133203262 16:4217621-4217643 AGTTGTGTGCAGAGGGAGTAAGG - Intronic
1133319695 16:4905281-4905303 AGGCTTGTTCAGATGGAGCACGG - Intronic
1133570351 16:7034353-7034375 AGGTTGGTGCTGGAGGAGAGGGG + Intronic
1133727671 16:8552802-8552824 GGGTTTGTGCAGAAACAGCAAGG - Intergenic
1133878825 16:9761755-9761777 AGGTTTGAGGAGAATAAGAATGG + Exonic
1137371211 16:47907371-47907393 AGGGTAGTGGAGAAGGAGAGTGG + Intergenic
1137682535 16:50362773-50362795 AGGTCTGAGGAGAGGGAGAAAGG + Intronic
1137771348 16:51017839-51017861 TGTTTTCTGCAGAAGGAAAAAGG - Intergenic
1138041351 16:53672373-53672395 AAGTTTGTTCCCAAGGAGAATGG - Intronic
1139252778 16:65512025-65512047 AGGGTTATTCAGAAGCAGAAAGG - Intergenic
1140265954 16:73420961-73420983 AATTTAGTGCAGAAGGAGAATGG - Intergenic
1141642582 16:85349838-85349860 AGGTTTGTGCTGCTGGTGAATGG - Intergenic
1141708559 16:85683724-85683746 AGGTTGGTGCAATAGGAGCAGGG - Intronic
1142058476 16:88015189-88015211 AGGGATGGGCAGAAGGAGCACGG - Intronic
1142314252 16:89333499-89333521 AGGGTTGTGCAGCAGGAACACGG - Intronic
1142480836 17:217251-217273 ATTTTAGTGCAGAAGAAGAAAGG - Intronic
1142480898 17:217587-217609 ATTTTAGTGCAGAAGAAGAAAGG - Intronic
1142480929 17:217757-217779 ATTTTAGTGCAGAAGAAGAAAGG - Intronic
1142480961 17:217927-217949 ATTTTAGTGCAGAAGAAGAAAGG - Intronic
1142480992 17:218097-218119 ATTTTAGTGCAGAAGAAGAAAGG - Intronic
1142481021 17:218267-218289 ATTTTAGTGCAGAAGAAGAAAGG - Intronic
1142481052 17:218437-218459 ATTTTAGTGCAGAAGAAGAAAGG - Intronic
1142497015 17:311287-311309 AGGCGTGTGCTGAAGGAAAAAGG - Intronic
1144169935 17:12649789-12649811 GGGTATGTGCAGAAGGAGAGGGG + Intergenic
1145818385 17:27811953-27811975 AGGTTGCTGCAGGAGGAGCAGGG + Intronic
1146239437 17:31203834-31203856 GGGTTTGTGTAGAAGTAGTAAGG + Intronic
1146822746 17:35997894-35997916 AGGTGTGGGCAGATGGAGACAGG + Intronic
1146912765 17:36658894-36658916 AGCTTTGTCCCAAAGGAGAAAGG - Intergenic
1148804443 17:50257250-50257272 TGGTGTGGGCAGATGGAGAAGGG + Intergenic
1150692879 17:67379632-67379654 AGCTTTGTGGAGAAAGAGAAGGG + Intronic
1151627693 17:75287788-75287810 AGGTGTGTGCAGGAGGGGAAAGG - Intronic
1153877021 18:9383032-9383054 ATGTTTGTAAATAAGGAGAAGGG + Intronic
1155366924 18:25058050-25058072 AAGTCTGTGAAGAGGGAGAAAGG - Intergenic
1155377558 18:25176974-25176996 AGATGTAGGCAGAAGGAGAAGGG - Intronic
1156747534 18:40410629-40410651 TTGTTAGAGCAGAAGGAGAAAGG - Intergenic
1156774184 18:40767070-40767092 TGGTTTGTGCAGAGTGAGGAAGG + Intergenic
1158276297 18:55771453-55771475 TGATCTGTGCAGAAGGAGACAGG + Intergenic
1158302077 18:56063582-56063604 AGGTCTGTGAAAAAGGAAAATGG + Intergenic
1159336463 18:67074116-67074138 AGGTGTGTGCAGCTGGTGAATGG - Intergenic
1160398236 18:78587986-78588008 AGGTGTGTGCAGAAGGAAGGGGG + Intergenic
1161670014 19:5601800-5601822 AATTTTGTGCAGCAGGTGAAAGG - Intronic
1161921301 19:7268201-7268223 CGGCAGGTGCAGAAGGAGAAAGG + Intronic
1162547297 19:11338628-11338650 AGCCTTGGGCAGAAGGAGACAGG - Intronic
1162572573 19:11481532-11481554 AGTCTTCTGCAGAAGGAGACTGG + Intronic
1164404144 19:27927548-27927570 ATTTTTGTGCAGAAGTGGAAAGG - Intergenic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1166271392 19:41716434-41716456 AGGTGTGTGGAGAAGGAGCCCGG + Intronic
1166644255 19:44519500-44519522 AGGTTTCTGCAGGGAGAGAAAGG - Intronic
1166675622 19:44738953-44738975 GGGTTTGGGCTGACGGAGAAAGG - Intergenic
1167421122 19:49404002-49404024 AGGTTACTGCAGAAGGAGGCAGG + Intronic
1167710430 19:51107181-51107203 AGGTTTATTCAGGAGGAGATGGG + Intronic
1168137432 19:54360760-54360782 AGGTGTGTGCAGAGGAAGAAGGG + Intronic
1168160645 19:54508322-54508344 AGGTGTGTGCAGAGGAAGAAGGG - Intronic
1168349823 19:55669378-55669400 AGGCTTGAGCAGAGGGAGACTGG + Intronic
924995991 2:361690-361712 AGGTTCATGCAGAAGAAAAAGGG + Intergenic
926008462 2:9390452-9390474 AGGTTTGTGAGGCAGAAGAAGGG + Intronic
926042069 2:9681408-9681430 AGGTGGGAGCAGAAGAAGAAGGG - Intergenic
926185075 2:10683973-10683995 AAGTTTCTTAAGAAGGAGAAAGG + Intronic
926340137 2:11898602-11898624 TATTTTGTGCAGAAGCAGAAAGG + Intergenic
927577155 2:24209312-24209334 AGCCTTGTTGAGAAGGAGAAAGG + Intronic
928999850 2:37335787-37335809 AGGTTTGGGCAGTAACAGAAGGG + Intergenic
930253388 2:49061006-49061028 AGGTATGGGCAGGGGGAGAAAGG - Intronic
931227097 2:60341030-60341052 AGGTTTGTGCAGACTGGGATGGG + Intergenic
933249710 2:80015560-80015582 TGGTGTGTGCAGAAGGATACGGG + Intronic
933819931 2:86101730-86101752 AGGGTTCTGCAGATGGAGAGTGG - Intronic
934173886 2:89562551-89562573 AGGTCATTGCAGAAGGAGAGAGG + Intergenic
934284200 2:91636900-91636922 AGGTCATTGCAGAAGGAGAGAGG + Intergenic
934861779 2:97769741-97769763 AGGTTTCTGCAGAACCAGGAAGG - Intronic
934862006 2:97771979-97772001 ATCTTTGTGCAGAAGTAAAATGG + Intronic
935131654 2:100265292-100265314 AGGGCTGGGGAGAAGGAGAAGGG - Intergenic
935133065 2:100275651-100275673 AGGTTTGAGGAAAAGGGGAAGGG + Exonic
935283977 2:101547143-101547165 ATGTTTCTGCAGAAGCAGAATGG - Intergenic
935579243 2:104742334-104742356 AGGTTGGAGAAGAAGAAGAAGGG - Intergenic
936052634 2:109236415-109236437 AAGTTTGAGGAGAAAGAGAATGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936579039 2:113680095-113680117 AGGTAATTGCAGAAGGAGATAGG - Intergenic
936666994 2:114608380-114608402 AGATTAGTGTAGAAGGAGAGGGG + Intronic
936970804 2:118174881-118174903 AGGTTTGACCTGATGGAGAAAGG + Intergenic
937363848 2:121246870-121246892 ACGTTTAAGCAGAACGAGAATGG - Exonic
937583454 2:123517073-123517095 AGCTTTGGGCACAAGGAGAAAGG + Intergenic
938751937 2:134340617-134340639 AGGTTTGTAAAGAAGGAGCCTGG - Intronic
939010182 2:136837299-136837321 AGGTAAGTGCAGAAGGAGAGTGG - Intronic
939966489 2:148615447-148615469 AGTTTTCAGCAAAAGGAGAATGG + Intergenic
940164766 2:150758349-150758371 CAGTTTCTTCAGAAGGAGAAAGG + Intergenic
940726076 2:157338022-157338044 AAGTCTGTGCAGAAGGAGCATGG - Intergenic
940727799 2:157354935-157354957 TGGTTTGTGGAGAAGGAAAAAGG - Intergenic
942779111 2:179620049-179620071 AGGTTTAGGCAAAAGGAGAAAGG - Intronic
943843123 2:192604636-192604658 TGGTGTGTGGAGGAGGAGAAGGG + Intergenic
945256080 2:207804369-207804391 GTGTGTGTGCAGAAGGAGACAGG + Intergenic
946556092 2:220859424-220859446 AGGTTGGTGAAGAAAGACAAAGG + Intergenic
1168919398 20:1518503-1518525 GGGTTTGTGGGGCAGGAGAAGGG + Intergenic
1168919739 20:1521402-1521424 AGCATTATGCAGAAGGAGGATGG + Intergenic
1169051447 20:2582015-2582037 TGGCTTGGGAAGAAGGAGAAGGG + Intronic
1169632021 20:7644469-7644491 AGGTTGGGGAAGATGGAGAAAGG + Intergenic
1169764299 20:9132174-9132196 TGGTCTGTGCAAAAGGACAAAGG + Intronic
1170586648 20:17739800-17739822 AGGTTTGTGAAGGAGAACAAAGG + Intergenic
1171361005 20:24586349-24586371 ATGCTTGTGCTGATGGAGAAGGG - Intronic
1172036581 20:32015070-32015092 AGGTGCGTGCAGGATGAGAAGGG + Exonic
1172844652 20:37922686-37922708 AGGGCTGTGCAGAGGGAGACAGG + Intronic
1174209155 20:48863446-48863468 GGGTTTGTGGAGAAGGAGCGGGG - Intergenic
1175124268 20:56739803-56739825 AGGCGTGTGCAGCAGGTGAAGGG + Intergenic
1175749109 20:61482947-61482969 AGGTTTGTGCAGCTGGAAGATGG + Intronic
1177009941 21:15719817-15719839 AGGTTTCTGCATTTGGAGAATGG + Intergenic
1178362377 21:31959210-31959232 TGTTTTGTGCAGAAGGAGGAAGG - Intronic
1178362640 21:31962067-31962089 TGGTTCATGCAGAGGGAGAAAGG + Intronic
1178412064 21:32372611-32372633 AGGTTTCTGCCGAAGAAGCAGGG - Exonic
1178450755 21:32697426-32697448 AGATTTGTCCAGCAGGAGACAGG - Intronic
1178789369 21:35685228-35685250 AGGGTTGTCCACATGGAGAAGGG + Intronic
1179035320 21:37754339-37754361 AGATTTCTGAATAAGGAGAAAGG + Intronic
1179106491 21:38405087-38405109 AGGTGTTTGCAGTAGGAGAATGG - Intronic
1179625245 21:42645597-42645619 AGCTTTGTACAGAAGGAGCAAGG + Intergenic
1181514893 22:23404772-23404794 AGGTCTGTGCAGTGGGAGCAAGG + Intergenic
1181676308 22:24455720-24455742 AGCTTTGTAAAGCAGGAGAATGG - Intergenic
1181984464 22:26789894-26789916 AGGTGTCTGCAGCAGGAGAGAGG + Intergenic
1182112561 22:27733845-27733867 AAGTTTGTCCAGGAGGTGAATGG - Intergenic
1182768574 22:32776675-32776697 AGGGTAGTGCAGAGGGAGCATGG - Intronic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1184511981 22:44939298-44939320 AGGTAAGTGGAGAAGGAGAGAGG + Intronic
1184587014 22:45454741-45454763 AGCCTGGTGCAGAAGGACAAGGG - Intergenic
1185025814 22:48411284-48411306 AGGTTTCTTCAGAAGGAGAGAGG + Intergenic
950812915 3:15666814-15666836 AGATTTGAACAGATGGAGAAGGG - Intergenic
950955008 3:17043320-17043342 AGGCTTGAGTAGAGGGAGAATGG + Intronic
952530703 3:34259148-34259170 AGGTTTGTTCACAGGGAGACAGG - Intergenic
952829947 3:37556288-37556310 AGGGTAGAGCAGAAGGAAAAAGG - Intronic
953002165 3:38945882-38945904 TGCTTTCTGGAGAAGGAGAAAGG - Intronic
953375484 3:42424647-42424669 AGGTGGGGGCAGAGGGAGAAGGG + Intergenic
953465459 3:43115572-43115594 AGGTATATGGTGAAGGAGAAGGG + Intergenic
955023342 3:55142830-55142852 ATGTTTGTGTATATGGAGAATGG + Intergenic
955156379 3:56420790-56420812 AGGCTGATGCAGGAGGAGAATGG + Intronic
956059444 3:65334873-65334895 AAGTTGGTGCTGAAGGAGACTGG + Intergenic
956151249 3:66245349-66245371 AGCATTGTGCAGAAGGGGTAGGG - Intronic
956489676 3:69757514-69757536 AGGTTTGGTCAGAAGTGGAATGG + Intronic
956788324 3:72661092-72661114 AGGATGGGGCAGAAGGAGGAGGG + Intergenic
957403914 3:79752549-79752571 AGGTGTGTGCAGAGGGTGAAAGG + Intronic
960511472 3:118554461-118554483 ATGGTTGTTCAGAAAGAGAATGG - Intergenic
962436759 3:135374031-135374053 AGCTTGGTGAGGAAGGAGAAGGG - Intergenic
962756391 3:138468250-138468272 AGGTGTGTGCAGGTGGAGGAAGG + Intronic
963661684 3:148134385-148134407 AGATGTGTGCAGAAGGCAAAGGG + Intergenic
963662254 3:148141750-148141772 ACTTTTATGAAGAAGGAGAAGGG + Intergenic
963970044 3:151420015-151420037 AGGTGCGTGCTGAAGGTGAAGGG - Intronic
964856377 3:161150398-161150420 AGGTTTTTGCAGCAGTAGAAAGG + Intronic
965034736 3:163423991-163424013 AGGTGTTTGCAGAAGGCAAAGGG - Intergenic
965379981 3:167976432-167976454 ATTTTTATGCATAAGGAGAAAGG + Intergenic
965847846 3:172985798-172985820 GGGTTTGTGTAGAGGAAGAAAGG + Intronic
966258378 3:177945945-177945967 AAGTTTGAGAAGAAAGAGAATGG + Intergenic
966975843 3:185082498-185082520 AGGTGTGGGGAGAAGGGGAAGGG + Exonic
967894740 3:194386663-194386685 AGGTTTATGCAGAAAGAAAAAGG + Intergenic
969827740 4:9771364-9771386 AGGTCACTGCAGAAGGAGAGAGG + Intronic
972401067 4:38704385-38704407 AAGGTTTTGCAGCAGGAGAAAGG + Intergenic
973040097 4:45458748-45458770 AGGTTTGTCAAGAATGGGAAAGG - Intergenic
973785277 4:54326821-54326843 AGGATTGTAGGGAAGGAGAAGGG - Intergenic
976191961 4:82495952-82495974 AGGTTTGTGCAGAATTATATGGG + Intronic
976373957 4:84323133-84323155 AGGTTCCTGCAAAAGGATAAAGG - Intergenic
976995321 4:91424395-91424417 AGGTTTGAGTAGGATGAGAAAGG - Intronic
977322319 4:95532984-95533006 AGGTTTGAGGAGAGTGAGAAAGG + Intronic
977588285 4:98799669-98799691 AGGCCTGTGTAGAAGGATAAAGG + Intergenic
978954041 4:114594208-114594230 AGGATTGTGCATTAGGAAAATGG + Intergenic
979944958 4:126817028-126817050 AGGTTAGTGCTGAAGGAATACGG + Intergenic
980887364 4:138777851-138777873 AGATTTGAGCAGAAGGACAGAGG + Intergenic
981250150 4:142591315-142591337 AGGTTTATTCAAAAGAAGAAAGG + Intronic
982097453 4:151935785-151935807 AGGGTTTTGTAGATGGAGAAGGG + Intergenic
982153744 4:152494317-152494339 AGTTTTCTGTAGAAAGAGAAAGG + Intronic
986605328 5:9517294-9517316 ATGTCTTTGCAGAAGGAAAAGGG + Intronic
986963858 5:13246565-13246587 AGGTCTGTGAACACGGAGAATGG - Intergenic
988818202 5:34854985-34855007 AGGGTTGTAAAGAAGGAGTAGGG + Intronic
989264465 5:39456969-39456991 AGGGTTGTCCAGAAGGAAGAAGG + Intronic
989537437 5:42581079-42581101 AGTTATGTGCAGAATAAGAATGG - Intronic
990529792 5:56661638-56661660 AGATTTGTTCAAAAGTAGAATGG - Intergenic
991951869 5:71954381-71954403 GAGTTTGTGCAGAATTAGAAAGG + Intergenic
992111011 5:73493812-73493834 ACATTTATGGAGAAGGAGAATGG - Intergenic
992286715 5:75242998-75243020 ATGTTTCTTCAGAAGCAGAAAGG + Intergenic
993185081 5:84607164-84607186 GAGTTTGTGGAGAAGGAGAAAGG + Intergenic
993799617 5:92316672-92316694 ATTTTTGTGCAAATGGAGAAAGG + Intergenic
994171019 5:96660197-96660219 AGGTGTGAACAGAAGGAGAAGGG - Intronic
995859913 5:116630025-116630047 TGGTCAGTGCAGAAGCAGAAAGG + Intergenic
996537234 5:124591229-124591251 AGGTTTCAGGAGAAGTAGAATGG - Intergenic
996684915 5:126269442-126269464 AAGTTTGAGTAGTAGGAGAAAGG - Intergenic
997146832 5:131443562-131443584 AGGTTTGTGCAGAAGGAGAAGGG - Intronic
997654869 5:135547240-135547262 AGGGTGGTGCAGAAGAAAAAGGG - Intergenic
997795457 5:136805350-136805372 TGGTTTGGGCAGAAGGGGAGAGG + Intergenic
998472112 5:142391488-142391510 AGGATGGGGCAGAAGGAGAAGGG + Intergenic
998747818 5:145281364-145281386 AGGTTTCTGCAGAAGTACAGTGG + Intergenic
999508704 5:152225301-152225323 ATGTTAGTGTAGAAGGGGAAGGG + Intergenic
999625949 5:153520443-153520465 AGCTTGGTGCATAAGAAGAAAGG + Intronic
1003410249 6:5855819-5855841 AGCTTTGTGCAGATGGACATGGG - Intergenic
1003755801 6:9118560-9118582 ACGTCTGAGCAGAAGAAGAATGG - Intergenic
1004852190 6:19711582-19711604 AACATTGAGCAGAAGGAGAATGG + Intergenic
1005255596 6:23999550-23999572 AGCTATCTGCAGAAGGCGAATGG + Intergenic
1006329549 6:33380480-33380502 AGTTTTGTGGAGAAGGTCAAGGG - Intergenic
1006369789 6:33636831-33636853 ACGTGAGTGCAGATGGAGAAGGG + Intronic
1006416086 6:33904689-33904711 AGGTTTGTGAAAAACCAGAATGG - Intergenic
1008893412 6:56522925-56522947 AGCTTTGTGGAAATGGAGAAAGG - Intronic
1009405725 6:63310087-63310109 AGTTTTGTACAGATGGAGATAGG - Intronic
1010104162 6:72148345-72148367 AGGTTTTTCTAGAAAGAGAAAGG - Intronic
1010648032 6:78417147-78417169 AGATTTGAGGAGAAAGAGAAAGG + Intergenic
1011195771 6:84777733-84777755 AAGTTTTTGCAGGAAGAGAAGGG - Intergenic
1011481178 6:87795625-87795647 ATGTTTGTAGAGAAGAAGAAAGG - Intergenic
1012272755 6:97235250-97235272 AGGTTTTTGCATAAGGAAATAGG + Intronic
1012390849 6:98737978-98738000 AGGCTTGAGCAAAAGGGGAATGG + Intergenic
1012828984 6:104182642-104182664 ATATTTGTGCTGAAGTAGAATGG - Intergenic
1013364844 6:109429271-109429293 AGGTCTGTGCAGAAGCAGGCTGG - Intronic
1013386415 6:109636165-109636187 GGGTTTGTGCAGTAGGAGGAAGG - Intronic
1014445555 6:121523309-121523331 AGGTTACTGTAGAAGGAGTAAGG + Intergenic
1014486601 6:122006888-122006910 AGGTGTGTTCAGATGGGGAAAGG + Intergenic
1016594609 6:145785383-145785405 TGCTTTGTGTGGAAGGAGAAAGG + Intergenic
1016754396 6:147667772-147667794 CTGTTTGTGAAGAAAGAGAATGG - Intronic
1018012262 6:159681849-159681871 TGGTTTTTGCAGTAGGAGAAAGG - Exonic
1018255708 6:161916901-161916923 AGGCTGGGGCAGGAGGAGAATGG - Intronic
1018367563 6:163137547-163137569 AGGTTTGGGGGGATGGAGAAAGG - Intronic
1018484401 6:164226573-164226595 ATATTTGTGCAGAATGAGTAAGG + Intergenic
1018667924 6:166156428-166156450 AGGGTTGTGGAGATGGACAAGGG + Intergenic
1018888348 6:167961496-167961518 AGATGTGAGCAGAAGGATAAAGG + Intronic
1019277108 7:181608-181630 AAGTTTCTGCAGCAGGAGAGGGG - Intergenic
1019563438 7:1668788-1668810 AGGTCGGGGCAGAGGGAGAAAGG + Intergenic
1020261869 7:6535404-6535426 AGGCTTGGGGAGAAGGAGAAGGG - Intronic
1020396932 7:7727084-7727106 AGGTGTGTGCTGAAGGCAAAGGG + Intronic
1022121714 7:27314714-27314736 ATTTCTGTGCAGAGGGAGAAAGG + Intergenic
1022235829 7:28459383-28459405 AGGTCTTTGCAAAAGGAAAAGGG - Intronic
1022991370 7:35711284-35711306 AGTTCTCTGCAGAAGGGGAAAGG + Intergenic
1023483598 7:40660849-40660871 AGGTGAGGGCACAAGGAGAATGG - Intronic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023912373 7:44565205-44565227 AGGTTGGGGCAGCAGGAGAGTGG - Intergenic
1026666039 7:72340564-72340586 AAGGTTTTGCAGCAGGAGAAGGG - Intronic
1027181355 7:75941886-75941908 AGGTTTGTTAATAAGAAGAATGG + Intronic
1027277372 7:76572301-76572323 AGGTTTACTCAGAGGGAGAAAGG + Intergenic
1028417160 7:90593389-90593411 ATGTTTTTTCAGTAGGAGAATGG - Intronic
1028487592 7:91377020-91377042 TGGCTTGTGGAGAATGAGAATGG - Intergenic
1028986465 7:97012995-97013017 AGGTTTCTGCCGCCGGAGAAAGG + Intergenic
1029246044 7:99202388-99202410 AGGTTGGGGTAGATGGAGAAGGG + Intronic
1030102915 7:105962147-105962169 AGGTTTTTGCAGCAATAGAAAGG - Intronic
1031388076 7:121177780-121177802 AGGTAGGGGCAGAAGGAAAAAGG - Intronic
1032504961 7:132427834-132427856 ATGTTTTTGCAAAAGGAAAATGG + Intronic
1032647052 7:133836396-133836418 AGAATTGGCCAGAAGGAGAAGGG - Intronic
1032868322 7:135952575-135952597 ATGTTGGTACAGAAAGAGAATGG - Intronic
1033926555 7:146469233-146469255 TGGATTGGTCAGAAGGAGAAGGG - Intronic
1034481957 7:151328730-151328752 ATTCTTATGCAGAAGGAGAAAGG + Intergenic
1034738349 7:153450224-153450246 AGGCTTGTGCAGAGGGAGAAAGG + Intergenic
1035927513 8:3744227-3744249 AGGTGTGTGCAACAGGAGCATGG + Intronic
1036943042 8:13069552-13069574 AGGTTTGAGATGAAGGAAAAGGG - Intergenic
1037635104 8:20694554-20694576 AGGGGTGAGCAGGAGGAGAAAGG - Intergenic
1038533554 8:28337975-28337997 TGTTCTGTGCATAAGGAGAAGGG + Intronic
1038534102 8:28341774-28341796 AGATGGTTGCAGAAGGAGAAAGG - Intronic
1038903137 8:31866359-31866381 AAGTTTGGGCAGCAAGAGAATGG + Intronic
1040985386 8:53288403-53288425 AGGAATATGCAGAAGGAGAAAGG - Intergenic
1041875612 8:62683714-62683736 AGGGTGGGGCAGAAGGAGAGAGG - Intronic
1041956539 8:63562373-63562395 AGGTCTGTGGGGAGGGAGAATGG + Intergenic
1042255018 8:66793920-66793942 AGGTATGTGGAGATGGGGAAGGG - Intronic
1044160730 8:88911708-88911730 AGGTCTGTGAGGAAAGAGAAGGG + Intergenic
1044204725 8:89479507-89479529 AGGTTTGTGCAAAATGAAATGGG - Intergenic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1044947158 8:97399984-97400006 AGGTATGGACAGAAGGACAAAGG + Intergenic
1045761581 8:105614734-105614756 AGATTTGGGGGGAAGGAGAAAGG - Intronic
1046670298 8:117049656-117049678 TGGTGTTTTCAGAAGGAGAAGGG - Intronic
1046734944 8:117766875-117766897 ATGTTTGTGCAACAGCAGAAAGG - Intergenic
1047039800 8:120980296-120980318 AGCCTTGTGCATATGGAGAATGG + Intergenic
1048571256 8:135658950-135658972 AGGTGGGTGCAGAAGCAGGAAGG + Intergenic
1049577684 8:143397247-143397269 AGGTTTGAGCAGAAGGGCATGGG - Intergenic
1050694779 9:8266559-8266581 AGCTTTCAGCACAAGGAGAATGG + Intergenic
1051161043 9:14207614-14207636 AGGTTTGTGGGGAAGGAGGAAGG - Intronic
1051174489 9:14348633-14348655 AGTATTGCGCAGAAGAAGAAGGG - Intronic
1052864766 9:33458232-33458254 AGGCTTGGGAAGAAGGAGAAGGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055944345 9:81679522-81679544 AGGTGTGGGCAGGAGGAGAGAGG - Intronic
1056077520 9:83056795-83056817 TGGTTTGTGCAAAAAGAAAAAGG - Intronic
1056218428 9:84427602-84427624 AGGTGTGTGCAGGAGGGGAGAGG - Intergenic
1057193532 9:93100718-93100740 AGGTGTGGGCAGAAGGAGAAAGG - Intronic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1059727529 9:117024052-117024074 TGGTTTGTGCAAAAGGAAATTGG - Intronic
1060313237 9:122483907-122483929 AGGTTTGTTCATTAGCAGAAAGG + Intergenic
1061992869 9:134169747-134169769 AGGTTTCTGGGGAGGGAGAATGG - Intergenic
1062434875 9:136542509-136542531 CGGCTTCTGCAGAGGGAGAAGGG + Intronic
1186137016 X:6532760-6532782 AGGTGTGTGGGGAGGGAGAAAGG - Intergenic
1186514913 X:10159797-10159819 AGGGTTGGGCTGGAGGAGAAGGG - Intronic
1186740107 X:12508233-12508255 AGCTTGGAGCAAAAGGAGAATGG - Intronic
1187023509 X:15408802-15408824 AGGCGAGTGCAGAAGGAGCAAGG + Intronic
1187203875 X:17162542-17162564 AGGCTTCTGCATAAGCAGAAAGG + Intergenic
1187792159 X:22962810-22962832 AGGGATGTGCAGATGGAGACTGG - Intergenic
1187924186 X:24235410-24235432 AGGTTGGTGAGAAAGGAGAAAGG - Intergenic
1188022429 X:25173612-25173634 AGGTGTGTGCAGAGAGGGAAAGG - Intergenic
1188986058 X:36769314-36769336 AAGTATGTGCTGAAGTAGAAGGG - Intergenic
1189205968 X:39239069-39239091 AGACTTGGGCAGAAGGAGACTGG + Intergenic
1189985165 X:46546864-46546886 GTGTTTATGCAGAAAGAGAAGGG + Intergenic
1190035325 X:47018209-47018231 AGGTGTGGGAAGAAGGAGATGGG - Intronic
1190098532 X:47502480-47502502 AGATGTGTGCACTAGGAGAAAGG - Intergenic
1190374598 X:49776486-49776508 TGGTTTGTGCTGATGGAGGAAGG + Intergenic
1190394987 X:49973109-49973131 AGGTTTGTGCAGAAGTGAAGAGG - Intronic
1190627773 X:52353081-52353103 AAGTGTGTGCACCAGGAGAAAGG - Intergenic
1191226625 X:58050776-58050798 TGGTCTGTGCTGAAGGAAAATGG + Intergenic
1191955817 X:66641522-66641544 AGGTGTGAGCAAAAGGAGAGGGG - Intergenic
1193223344 X:78953146-78953168 AGGCTGGTGTAGCAGGAGAATGG + Intronic
1193539998 X:82759479-82759501 AGATTTTGGCAGAAAGAGAAGGG - Intergenic
1196109388 X:111929995-111930017 ATGTTTGAGCAGAGGCAGAATGG - Intronic
1197162560 X:123340316-123340338 ATGTTTGTGGATAATGAGAAAGG - Intronic
1199904203 X:152207722-152207744 AGAGTGGTGCAGAAGGTGAAGGG - Intronic