ID: 997150189

View in Genome Browser
Species Human (GRCh38)
Location 5:131485212-131485234
Sequence CCACCATGCTTGGCTAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 1, 2: 5, 3: 62, 4: 405}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997150179_997150189 21 Left 997150179 5:131485168-131485190 CCTCCCGCCTCAGCCTCCTAAAT 0: 13
1: 1124
2: 32240
3: 161575
4: 233407
Right 997150189 5:131485212-131485234 CCACCATGCTTGGCTAGAAGTGG 0: 1
1: 1
2: 5
3: 62
4: 405
997150186_997150189 5 Left 997150186 5:131485184-131485206 CCTAAATTGCTAGGATTACAGGC 0: 200
1: 19750
2: 260981
3: 331777
4: 348868
Right 997150189 5:131485212-131485234 CCACCATGCTTGGCTAGAAGTGG 0: 1
1: 1
2: 5
3: 62
4: 405
997150181_997150189 17 Left 997150181 5:131485172-131485194 CCGCCTCAGCCTCCTAAATTGCT 0: 35
1: 2833
2: 74922
3: 191841
4: 207053
Right 997150189 5:131485212-131485234 CCACCATGCTTGGCTAGAAGTGG 0: 1
1: 1
2: 5
3: 62
4: 405
997150184_997150189 8 Left 997150184 5:131485181-131485203 CCTCCTAAATTGCTAGGATTACA 0: 22
1: 1295
2: 38124
3: 364279
4: 394205
Right 997150189 5:131485212-131485234 CCACCATGCTTGGCTAGAAGTGG 0: 1
1: 1
2: 5
3: 62
4: 405
997150180_997150189 18 Left 997150180 5:131485171-131485193 CCCGCCTCAGCCTCCTAAATTGC 0: 45
1: 3060
2: 83674
3: 370619
4: 502982
Right 997150189 5:131485212-131485234 CCACCATGCTTGGCTAGAAGTGG 0: 1
1: 1
2: 5
3: 62
4: 405
997150182_997150189 14 Left 997150182 5:131485175-131485197 CCTCAGCCTCCTAAATTGCTAGG 0: 5
1: 521
2: 14260
3: 145172
4: 465501
Right 997150189 5:131485212-131485234 CCACCATGCTTGGCTAGAAGTGG 0: 1
1: 1
2: 5
3: 62
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997150189 Original CRISPR CCACCATGCTTGGCTAGAAG TGG Intronic
901498248 1:9635120-9635142 CCACCACGCCTGGCTAAGAGAGG - Intergenic
902176924 1:14657368-14657390 CCACCATGCCTGGCTGGGAGAGG + Intronic
902607583 1:17577331-17577353 CCACCATGACTGGCCTGAAGTGG + Intronic
902854099 1:19187373-19187395 CAAGCTTGCTTGGCCAGAAGTGG + Intronic
902895358 1:19476033-19476055 CCACCATGCCTGGCCAAAATTGG - Intronic
903655106 1:24944179-24944201 CCATCAAGCCTGGCTAGAAGGGG - Intronic
904057029 1:27677836-27677858 CCACCATGCTTGGCTAATTATGG - Intergenic
904112249 1:28135255-28135277 CCACCGTGCCTGGCCAGAAAAGG - Intergenic
904564396 1:31419538-31419560 CCACCATGCCTGGCCATTAGGGG - Intronic
904583836 1:31567989-31568011 CCACTATGCCTGGCCAAAAGTGG - Intergenic
904803346 1:33113129-33113151 CCACCATGCCTGGAGAGATGGGG + Intronic
905019846 1:34801612-34801634 CCACCATGCCTGGCTAGTGAGGG + Intronic
905672111 1:39798664-39798686 CCACCATGCCTGGCCAGAGCAGG - Intergenic
906023077 1:42648225-42648247 CCACCATGCCTGGCCTTAAGAGG + Intronic
906095370 1:43219804-43219826 CCACCATGCCTGGCTAGAGATGG - Intronic
906151365 1:43589567-43589589 CCACCGTGCCTGGCCAGAATCGG - Intronic
906260546 1:44385370-44385392 CCACTGTGCCTGGCAAGAAGAGG - Intergenic
906277650 1:44528899-44528921 CCACCACGTTTGGCCAGAATTGG + Intronic
907032516 1:51186377-51186399 CCACCATGCCCGGCCAGCAGTGG - Intergenic
907093280 1:51749712-51749734 CCACCGTGCTTGGCTCTAAATGG - Intronic
907144403 1:52219400-52219422 CCACCACACTGGGCTAAAAGGGG - Intronic
907195488 1:52683216-52683238 CCACCATGCCTGGCCAAAATGGG - Intergenic
907354892 1:53864027-53864049 CCACCAAGCCTGGCCTGAAGTGG + Intronic
907581250 1:55574650-55574672 CCACAATGCTTGGAGAGGAGGGG - Intergenic
907584912 1:55608481-55608503 GCTCCAGGCTTGGCTAAAAGAGG - Intergenic
908221330 1:62009795-62009817 CCACCAGGCCTGGCCAAAAGTGG - Intronic
908286657 1:62611855-62611877 CCACCATGCCTGGCCAGATAAGG - Intronic
908715723 1:67067659-67067681 GCACCAGCCTTGGCTAAAAGAGG + Intergenic
910401040 1:86838475-86838497 CCACCATGCTTGGCTTCTACTGG - Intergenic
911734298 1:101320557-101320579 CCACCACGCTTGGCCATAAAAGG + Intergenic
912361930 1:109102312-109102334 CCACCGCGCCTGGCTGGAAGGGG + Intergenic
917145094 1:171882057-171882079 CCACCATGCCCGGCCACAAGAGG - Intronic
918011908 1:180594758-180594780 CCTTCCTGCTTGGCTAAAAGAGG - Intergenic
919201060 1:194356119-194356141 CCACCATGCCTGGCAATAATTGG + Intergenic
919876810 1:201875300-201875322 CCACCATGCCTGGCTATAAATGG - Intronic
919946997 1:202326835-202326857 CCACCATGCATGGCCTGAATAGG + Intergenic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
923701811 1:236306913-236306935 CCACCATGCTGGGCCAGAAGAGG + Intergenic
1062785853 10:264105-264127 CCACCACGCCTGGCCACAAGTGG + Intergenic
1063446666 10:6122458-6122480 CCACCATGCTGAACGAGAAGAGG - Intergenic
1064055846 10:12096536-12096558 CCACTATGCCTGACTAGATGGGG + Intronic
1064259216 10:13771358-13771380 CCACCACGCCTGGCCAGCAGAGG + Intronic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1065311597 10:24421291-24421313 CCATCATGCCTGGCTGTAAGTGG + Intronic
1065831818 10:29621440-29621462 CCACCATGCTTGGGAAACAGGGG + Intronic
1065977306 10:30853707-30853729 CCACCATGCCTGGCCATAAATGG - Intronic
1066361578 10:34736962-34736984 CCACCATGCCTGGCCAAAATAGG + Intronic
1066371249 10:34819993-34820015 CCACCATGCTCAGCTAGAACTGG - Intergenic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067567282 10:47348547-47348569 GCACCAGGCTTGGCTGGAACAGG - Exonic
1067928983 10:50540668-50540690 CCACCATGACTGGATTGAAGAGG + Intronic
1069246422 10:66212714-66212736 CCACCATGCTTGCCCAAAAAAGG - Intronic
1069970739 10:72166313-72166335 CCACTGTGCCTGGCTAGAAAAGG - Intronic
1070906287 10:80076325-80076347 CCACCACGCTTGGCTAATTGTGG - Intergenic
1072487483 10:95869535-95869557 CCACCATGCCTGGCCAGAAGTGG + Exonic
1072698629 10:97623290-97623312 CCACCATGCTTGGTTGATAGAGG - Intronic
1075101143 10:119507140-119507162 CCAGCATGCTCCGCTAGAAAGGG - Intronic
1075675775 10:124294896-124294918 CCACCCTGCTTGGCTGGCACAGG + Intergenic
1075786124 10:125051350-125051372 CCACCATGCCTGGCCTGAAAAGG - Intronic
1076660412 10:132052070-132052092 CCACCATGCCTGGCTAATTGTGG - Intergenic
1077078388 11:711594-711616 CTACCAGGCCTGGCTAGGAGGGG - Intronic
1078044080 11:7897230-7897252 CCACCATGCTTGACTATACATGG + Intergenic
1079486497 11:20940848-20940870 CCACCACGCCTGGCTGGAGGTGG - Intronic
1080505271 11:32906549-32906571 CCACCATGCCTGGCTAAATTCGG + Intronic
1081616738 11:44595780-44595802 CTACCATGTCTGGCCAGAAGGGG - Intronic
1081790755 11:45782208-45782230 CCACCATGCCTGGCCATAAATGG + Intergenic
1081911659 11:46704018-46704040 CCACCGTGCCCGGCTGGAAGGGG + Intronic
1082052132 11:47779878-47779900 CCACCATGCCTGGCTAGTTTTGG + Intronic
1082086530 11:48054895-48054917 CCACCATGCCTGGCTGCCAGCGG - Intronic
1082935352 11:58650969-58650991 CCACCATGCCTGGCCAGCAATGG + Intronic
1083582490 11:63833765-63833787 CCACCATGCCTAGCTAACAGGGG + Intergenic
1084254589 11:67931575-67931597 CCACCATGATTGGTCAGAATAGG + Intergenic
1084818283 11:71664312-71664334 CCACCATGATTGGTCAGAATAGG - Intergenic
1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG + Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085212394 11:74792686-74792708 CCACCATGCCTGGCAAGAGTAGG + Intronic
1085695635 11:78702229-78702251 CCACCTTGCTTAGCAGGAAGTGG + Exonic
1086190604 11:84074446-84074468 CCAACATGTTTGGGTAGAAGTGG - Intronic
1087768566 11:102182104-102182126 CCACCATGCCTGGCCCTAAGTGG + Intronic
1089481018 11:118805122-118805144 CCACCGTGCCTGGCCAGAACTGG + Intergenic
1090844490 11:130519414-130519436 CCTCCAAGTTTGGGTAGAAGTGG + Intergenic
1091811872 12:3406182-3406204 GCTCCATCCTTGGCTAAAAGGGG - Intronic
1092424661 12:8365056-8365078 CCACCATGATTGGTCAGAAGAGG + Intergenic
1093191476 12:16079852-16079874 CCACCATGCCTGGCTAAATTTGG + Intergenic
1093219345 12:16400227-16400249 CCATCATGTTTGGGAAGAAGTGG - Intronic
1094189929 12:27687793-27687815 CCACTATACTTGGCCAGAAAAGG - Intronic
1094357199 12:29590497-29590519 CCACCATGCCTGGCCACACGTGG - Intronic
1094459996 12:30685770-30685792 CCACCATGCTTGGCTAATTTTGG - Intronic
1096257383 12:50071796-50071818 CCACCATACCTGGCTAGAGAAGG + Intronic
1096451430 12:51745524-51745546 CCACAATATTTGGCTAGAATTGG - Intronic
1096479712 12:51930979-51931001 CCACCGTGCCTGGCCAGAAGAGG - Intergenic
1096492316 12:52019473-52019495 CCCCCATGCTAGGGCAGAAGGGG + Intergenic
1097034247 12:56112239-56112261 CCACCATGCCTGGCTCAAAATGG + Intronic
1097211328 12:57372916-57372938 CCCCCATGCTTGGCCAGAGTTGG - Intronic
1097793381 12:63838867-63838889 CCACCAGGCCTGGCTAGCTGTGG - Intergenic
1098125923 12:67292843-67292865 CCTCCCTCCTTGGCCAGAAGGGG - Intronic
1099607914 12:84828725-84828747 CCTCCAAGCATGGCTAAAAGGGG + Intergenic
1099961079 12:89397489-89397511 CCACCGTGCCTGGCCAGAAGAGG + Intergenic
1099996677 12:89786439-89786461 CCTCCAGCCATGGCTAGAAGGGG + Intergenic
1100499578 12:95160893-95160915 CCACCATGCCTGGCCACAAGTGG - Intronic
1100508549 12:95244943-95244965 CCACCTTGCCTGGCCAAAAGTGG - Intronic
1100533338 12:95481143-95481165 CCACCAGGCCTGGCCAGCAGAGG - Intronic
1101703481 12:107197679-107197701 CCACCATGCCTAGCTAAATGAGG + Intergenic
1101877893 12:108607570-108607592 CCACTGTGCCTGGCTAGGAGGGG - Intergenic
1101975433 12:109353940-109353962 CCACCACGCCTGGCCAGCAGTGG + Intronic
1102417958 12:112780865-112780887 CCACCATGCCCGGCTACCAGAGG - Intronic
1103025526 12:117570968-117570990 CCACCGTGCCTGGCTGGAATAGG - Intronic
1103362167 12:120360940-120360962 CCACCAAGCCTGGCTATGAGAGG + Intronic
1103547205 12:121710783-121710805 CCACCATGCCTGGCCAGAAAGGG + Intergenic
1106254830 13:28012645-28012667 CCACCACGCCTGGCTAAGAGAGG - Intronic
1106398932 13:29409030-29409052 CCACCATGCCCAGCTATAAGTGG - Intronic
1107282917 13:38756826-38756848 CCACCATGCCTGGCTGGTTGGGG + Intronic
1108197185 13:48006912-48006934 CCACCATGCCTGGCTGGGATTGG - Intergenic
1108597134 13:51959354-51959376 CCACCATGCCTGGCTAGATAGGG - Intronic
1108746196 13:53397136-53397158 CCACCCTGCTTGGCTAGTTTTGG + Intergenic
1110080569 13:71305032-71305054 CCAGCATGCTTGGGGAGCAGCGG + Intergenic
1111626467 13:90794246-90794268 CCACCATGCCTGGCCAGACAGGG + Intergenic
1112005605 13:95251073-95251095 CCACCAAGCTTGGCCAATAGTGG + Intronic
1114290979 14:21288331-21288353 CCACCATGCCTGGCTAGTTTTGG + Intronic
1114299254 14:21359583-21359605 CCATCATGTTTGGGAAGAAGCGG - Exonic
1114312527 14:21480118-21480140 CCACCATGCCAGGACAGAAGTGG + Intronic
1114321690 14:21551959-21551981 CCACCATGCCTGGCCCCAAGGGG - Intergenic
1114649861 14:24277719-24277741 CCACCATGCTTTGCTGGAGCCGG + Intergenic
1115213777 14:30994161-30994183 CCACCAGGCCTGGCGAGACGGGG + Intronic
1116007731 14:39314096-39314118 CCACCATGCCCGGCCAGATGTGG - Intronic
1116020463 14:39454045-39454067 CCACCATGCCTGGCTAGTTTTGG + Intergenic
1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG + Intergenic
1119036508 14:71234129-71234151 GCACAGTGCCTGGCTAGAAGCGG - Intergenic
1119560727 14:75587472-75587494 TGACCATGCTAGGTTAGAAGAGG - Intronic
1120233631 14:81866212-81866234 CCACCGTGCCTGGCCAGATGTGG + Intergenic
1120501327 14:85300647-85300669 CCACCATGCCTGGCCAGATATGG - Intergenic
1120687482 14:87554894-87554916 CCACCACGCCTGGCCAGAAAAGG - Intergenic
1120704563 14:87733757-87733779 CCAGCCTGCTTGGCAAGGAGGGG + Intergenic
1122578661 14:102757569-102757591 CCACCACGACAGGCTAGAAGTGG - Intergenic
1123822332 15:24043421-24043443 CCACTTTCCTTGGCTAGAAAAGG - Intergenic
1125116874 15:36104187-36104209 TCATCATGCTTTGCTAGCAGGGG - Intergenic
1125794404 15:42393878-42393900 CCACCACGCCTGGCCAGCAGGGG + Intronic
1126017504 15:44366479-44366501 CCACCATGCATGGCTAATTGTGG - Intronic
1126072581 15:44877907-44877929 CCACCATGCCTGGCCTCAAGAGG + Intergenic
1126527837 15:49677440-49677462 CCACCATGCCTGGCTTGAACTGG + Intergenic
1126636591 15:50786116-50786138 CCACCATGCTTGGCTAATTTTGG + Intergenic
1128032332 15:64491952-64491974 CCACCACGCCTGGCTCGATGTGG - Intronic
1128344782 15:66846671-66846693 CCACCACGCCTGGCTGGAAGTGG + Intergenic
1128479397 15:68024260-68024282 CCACCATGCCTGGCCAGTGGTGG - Intergenic
1129015352 15:72462908-72462930 CCACCATGCTTGGCCAGCTCAGG + Intergenic
1129028218 15:72598971-72598993 CCACCATGCCTGGTTAGGAATGG + Exonic
1129087744 15:73114076-73114098 ACACCATGCTTGCTTAGAACAGG + Intronic
1129260955 15:74367001-74367023 CCACCATGCCTGGCCAGACCTGG + Intronic
1129602072 15:77005094-77005116 CCACCATGCTTGGCCAGCAATGG - Intronic
1129788742 15:78326605-78326627 CCACCATGCCTGGCCTGAATTGG - Intergenic
1131240983 15:90743147-90743169 CCACCATGCCTGGCTAAAGATGG + Intronic
1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG + Intergenic
1132583854 16:697350-697372 CCTCCATGCTTGCCTCGAAACGG - Exonic
1132753466 16:1470282-1470304 CCACCATGCCTGGCTCAAAATGG + Intronic
1133193176 16:4149689-4149711 CCACCGTGCTTGGCCCAAAGCGG - Intergenic
1134253098 16:12588540-12588562 CCACCATGCCTGGCTGGATCTGG - Intergenic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1135094448 16:19553756-19553778 CCACCATGCCTGGCTAATATCGG - Intergenic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1135799220 16:25476921-25476943 CCACCATGCCTGGCCCAAAGCGG + Intergenic
1136155792 16:28381110-28381132 CCACCACGCCTGGCTGGAAGAGG - Intronic
1136207292 16:28734179-28734201 CCACCACGCCTGGCTGGAAGAGG + Intronic
1137605250 16:49782834-49782856 CCACCATGCTTAGCGTGAAGTGG - Intronic
1138256692 16:55570480-55570502 CCAACTTGCTTGGCTAGTTGTGG - Intronic
1138418733 16:56886085-56886107 CCACCATGCTGGGCTAGGCAGGG + Intronic
1138525974 16:57607431-57607453 CCACCATGCCTGGCCAGCACTGG - Intergenic
1138754420 16:59465895-59465917 CCACCATGCCTGGCCACAACAGG + Intergenic
1139400011 16:66674004-66674026 CCACCAAGCTTGTCTGGCAGGGG - Intronic
1140452689 16:75083715-75083737 CCCCCATGCTTGGCTCAAGGAGG - Intronic
1140960383 16:79906433-79906455 CCACCATGCCTGGCCACATGTGG - Intergenic
1141095556 16:81160407-81160429 CCACCACACTTGGCTGAAAGTGG + Intergenic
1141520787 16:84577530-84577552 CCACCATGCCTGGCCGGAACAGG + Intronic
1141712320 16:85707197-85707219 CCACCATGCCTGGCCACAAATGG - Intronic
1142052519 16:87968039-87968061 CCACCACGCCTGGCCAGAAAAGG + Intronic
1142871826 17:2826280-2826302 CCACCATGCCTGGCCTGCAGGGG + Intronic
1145868189 17:28254023-28254045 CCACCATGCCTGGCCAGGAGCGG - Intergenic
1146075404 17:29724239-29724261 CCACCCTGCCCGGCTAGAATAGG - Intronic
1147404559 17:40201610-40201632 CCACCATGCCTGGCCAGGAAGGG - Intergenic
1147766301 17:42838603-42838625 CCACCATGCCTGGCCAGACTAGG + Intronic
1147952948 17:44117196-44117218 CCACCTGTCTTGGCTAGCAGGGG + Intronic
1148085187 17:44989654-44989676 CCAGCATGCGTGGCTATAGGGGG - Intergenic
1148970206 17:51473376-51473398 CCATCATTTTGGGCTAGAAGGGG + Intergenic
1149488917 17:57067906-57067928 CAGCTGTGCTTGGCTAGAAGGGG + Intergenic
1149899194 17:60458144-60458166 CCACCATGCCTGGCTGGAAAAGG - Intronic
1149938191 17:60831022-60831044 CCACCAGACTCGGCTAGACGGGG + Intronic
1150354496 17:64471408-64471430 CCCACATGCTAGTCTAGAAGTGG - Intergenic
1152557279 17:81059736-81059758 CCACCACGCCTGGCTGAAAGAGG + Intronic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1153832815 18:8938241-8938263 CCACCATGCCTGGCCACAGGTGG - Intergenic
1155294100 18:24369932-24369954 CCACCATGCTCGGCCAGCAGTGG - Intronic
1155456144 18:26016433-26016455 CCACCGTGCCTGGCCAGAATAGG - Exonic
1155613076 18:27690791-27690813 CCACCATGCCTGGCCAGAAATGG + Intergenic
1157207478 18:45712871-45712893 CCACCATGCCTGGCCAAAGGAGG + Intergenic
1157413009 18:47479609-47479631 GCACCATGCTTGGCAGGCAGAGG + Intergenic
1157914777 18:51654539-51654561 CAGCCATCCTTGGCTAGAAGGGG - Intergenic
1158908486 18:62036995-62037017 CCACTCTGCTTGACTAGGAGAGG + Intergenic
1160225433 18:77008009-77008031 CCACTCTGCTTGGCTACACGGGG + Intronic
1160628481 18:80229223-80229245 CCACCACAATTGGCCAGAAGTGG + Intronic
1161219994 19:3114043-3114065 CCTCCATGCTTGGCAGGCAGAGG + Intronic
1161514410 19:4688766-4688788 CCATCATGCTAGCCCAGAAGCGG + Exonic
1162244122 19:9384562-9384584 CCACCATGCCTGGCCGGAACTGG + Intergenic
1162285215 19:9733565-9733587 CCACCACGCCTGGCTAGAGATGG - Intergenic
1162611211 19:11755025-11755047 CCACCATGCCTGGCCCAAAGAGG - Intergenic
1162925216 19:13927489-13927511 CCACCATGCCTGGCCAAGAGTGG - Intronic
1163040858 19:14601188-14601210 CCACCACGCTGGGCTAGGAGGGG + Intronic
1163345139 19:16736380-16736402 CCACCATGCTTGGCTTTGACTGG + Intronic
1163411584 19:17158282-17158304 CCACCGTGCCTGGCTGGCAGGGG - Intronic
1163432694 19:17277724-17277746 CCACCACGCCTGGCTAGAGGGGG - Intronic
1163456131 19:17406652-17406674 CCACCATGCCTGGCTCTAAGTGG - Intronic
1163584243 19:18155465-18155487 CCACCATGCTCGGCCAGCTGAGG - Exonic
1163744569 19:19037636-19037658 CCACCATGCCTGGCCTGAAGTGG + Intronic
1164561174 19:29293250-29293272 CCTCCCTGCTAGGCTAAAAGTGG - Intergenic
1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG + Intergenic
1165861827 19:38913070-38913092 CCACTATGCTTGGCTGAGAGTGG + Intergenic
1166687539 19:44804723-44804745 CTGCCATGCATGGCTGGAAGAGG + Intergenic
1166826802 19:45614906-45614928 CCACCATGCCCGGCCAGATGCGG - Intronic
1166971327 19:46570290-46570312 CCACCATGCCTGGCCACAATGGG + Intronic
1166996471 19:46721943-46721965 CCACCAGGGTTGGGGAGAAGGGG - Intronic
1167032879 19:46975155-46975177 CCACCATGCCTGGCCAGAAGGGG + Intronic
1167510399 19:49892812-49892834 CCCCCATCCTGGTCTAGAAGGGG + Intronic
1168278243 19:55288870-55288892 CCACCGTGTCTGGCCAGAAGTGG + Intronic
926220773 2:10934305-10934327 CCACCATGCTCTGCTTGGAGAGG + Intergenic
927527560 2:23760371-23760393 CCACCATGCCTAGCTGGAAATGG - Intronic
927570624 2:24156343-24156365 CCACCACGCCTGGCCAGAAGGGG - Intronic
927704813 2:25290607-25290629 CCACCACGCCCGGCCAGAAGTGG + Intronic
928322727 2:30296161-30296183 CCACCCTGCAGGGCTTGAAGAGG + Intronic
930028918 2:47046502-47046524 CCACCATGCCTGCCAAGATGGGG + Intronic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930814218 2:55575723-55575745 CCACCACGCTTGGCTAGACAAGG + Intronic
931969507 2:67569992-67570014 CCTCCATGTTTGCCTAGAATTGG - Intergenic
932138822 2:69256773-69256795 CCACCATGCCTGGCTAGAGATGG - Intergenic
933722528 2:85407423-85407445 CCACCATGCCTGGCTGGCACTGG - Intronic
934569331 2:95358843-95358865 GCATCATGCTTGGCAAGAGGTGG - Intronic
934684969 2:96314340-96314362 CCACCATGCCTGGCCTGAATGGG + Intergenic
934723666 2:96601113-96601135 CCACCATGCCCGGCTACAACAGG - Intronic
934724047 2:96603569-96603591 TCACCATGCCTGGCCAGGAGAGG + Intronic
935821518 2:106897500-106897522 CCACCATGCCTGGCTAGGTTTGG + Intergenic
935939702 2:108225352-108225374 CCACCATGTGAAGCTAGAAGAGG - Intergenic
935976522 2:108584287-108584309 CCACCATGCTTAGCTCTGAGAGG + Intronic
936102700 2:109597226-109597248 CCACCGTGCCTGGCTGGAAAAGG + Intronic
937364450 2:121250890-121250912 CCACCATGCCTGGCCAGTATTGG + Intronic
938898577 2:135777597-135777619 CCACCATGCCTGGCCTGAGGTGG - Intronic
940510085 2:154602515-154602537 CCACCATGCTCGGCTCTAAGTGG + Intergenic
941968958 2:171329136-171329158 CCACCATGCCTGGCTACAGGAGG + Intronic
942230013 2:173852002-173852024 GCACCATGTTTAGCTGGAAGTGG + Intergenic
942242199 2:173972858-173972880 CCACCACGCCTGGCCAGCAGTGG - Intergenic
944316491 2:198290757-198290779 CCACCATGCTCGGCTAAATTTGG - Intronic
944394740 2:199253867-199253889 CCACCGTGCCTGGCCTGAAGAGG - Intergenic
946234434 2:218314521-218314543 CCACCATGCCTGGCTATACTTGG + Intronic
946839855 2:223809355-223809377 CCACCATGCCCAGCCAGAAGTGG - Intronic
947404048 2:229756101-229756123 CCCCCATGCCTGGCCAAAAGTGG + Intergenic
947626998 2:231625938-231625960 CCACCATGCATGGCTACCAATGG - Intergenic
947929335 2:233950618-233950640 CCTCCCTGCTGGGCTAGACGTGG + Intronic
948496835 2:238356207-238356229 CCACCATGCCTGGCCAGGAATGG - Intronic
948947176 2:241226722-241226744 CCAACATGTTTGGCTTTAAGAGG + Intergenic
1169089908 20:2853101-2853123 CCACCATGCCCGGCTGAAAGTGG - Intronic
1169861096 20:10153450-10153472 CCACCATGCCTGGCCTGAGGCGG - Intergenic
1170837301 20:19895313-19895335 GCACCATTCTTTGCTATAAGAGG - Intronic
1171755212 20:29100907-29100929 CCACCATGCCTTAATAGAAGTGG + Intergenic
1172309575 20:33907380-33907402 CCACCATGCCTGGCTCTAATTGG + Intergenic
1172357072 20:34287677-34287699 CCACCGTGCCTGGCCAGAAGGGG + Intronic
1173520482 20:43696391-43696413 CCACCATGCCTGGCTAATTGGGG + Intronic
1174019503 20:47518710-47518732 CCACCATGCCTGGCCAATAGAGG + Intronic
1174784492 20:53419794-53419816 CCACCTTGCTGGGGCAGAAGGGG + Intronic
1176082393 20:63280443-63280465 CCACCATGCCTGGCCAGAAAGGG + Intronic
1178699411 21:34820360-34820382 CCACCATGCCTGGCTGGAGGAGG - Intronic
1178918333 21:36722164-36722186 CCACCGTGCTTGTCTGGAAATGG + Intronic
1178953415 21:37004160-37004182 CCACCACGCCTGGCTAGGTGTGG - Intergenic
1179222258 21:39418785-39418807 CCACCATGCCTGGCCAGAAATGG + Intronic
1180217803 21:46337147-46337169 CCACCATGCCTGGCTAATTGGGG + Intronic
1180638528 22:17279682-17279704 CCACCGTGCCCGGCCAGAAGTGG - Intergenic
1181002323 22:19993663-19993685 CCAGCATGTTTGGCAAGAAGTGG - Intronic
1181135424 22:20762640-20762662 CCAGCATGTACGGCTAGAAGAGG - Intronic
1182888547 22:33797049-33797071 CCACCATGCCTGGCCAGACTTGG + Intronic
1183274786 22:36887165-36887187 CCACCATGCTTGGCCATGTGAGG + Intergenic
1184285238 22:43466892-43466914 CCACCATGCCTGGCCAGACAGGG - Intronic
1184752465 22:46495661-46495683 CCACCATGCCTGGCTAAACAGGG - Intronic
1184849201 22:47110190-47110212 CCACCGTGCCTGGCCAGAAAAGG - Intronic
1185401160 22:50618099-50618121 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
950022854 3:9800710-9800732 CCACCATGCCTGGCCAGTAGAGG + Intronic
950025117 3:9814948-9814970 CCACCATGCCCGGCCAGAAATGG - Intronic
950056956 3:10032591-10032613 CCACCTTGCCTGGCCAGAAATGG + Intronic
950153374 3:10705585-10705607 CTACCATGCTTCCCTAGAAATGG - Intronic
950751941 3:15136146-15136168 CCACCATGATTGGTCAGAATAGG - Intergenic
953398171 3:42589502-42589524 CCACCACGGATGGCTAGAACAGG + Intronic
953442466 3:42930134-42930156 CCACCATGCCTGGCCATAAATGG - Intronic
954087320 3:48255774-48255796 CCACCATGCCTGGCCAGAGACGG + Intronic
954526598 3:51277398-51277420 CCACCATGCCTGGGCAGCAGTGG + Intronic
954804684 3:53210583-53210605 CCACCATGCCCGGCCAGAATGGG - Intergenic
956117182 3:65930442-65930464 CCACCGTGCCTGGCCACAAGTGG - Intronic
956817752 3:72923916-72923938 CCACCATGCCTGTCCAGCAGTGG + Intronic
956845449 3:73178226-73178248 CCACCATTCTTGGCAAGAGTAGG + Intergenic
957068667 3:75548158-75548180 CCACCATGATTGGTCAGAATAGG + Intergenic
958963925 3:100537208-100537230 CCACCATGCCTGGCCAGAATAGG + Intronic
959263738 3:104113033-104113055 CCACCTTCCTTGGCTGGGAGTGG - Intergenic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
960764689 3:121112367-121112389 CCACCTTGCTTGGCTGGGAGTGG + Intronic
961626755 3:128269435-128269457 CCACCAATCATGGCTGGAAGAGG - Intronic
962618560 3:137152887-137152909 TCATCATGCTTTGCTAGCAGGGG - Intergenic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
964644634 3:158945783-158945805 CCACAATGCTTTGTTAGAAGAGG + Intergenic
965339136 3:167464299-167464321 CCACCATGCCTGGCCAGGAGTGG + Intronic
965891428 3:173519255-173519277 CCACCATGCTGCCCTAGTAGAGG - Intronic
966110296 3:176392971-176392993 CCACCATGCCTGGCTAGTTTTGG + Intergenic
966184504 3:177215863-177215885 CCACCATGCCTGGCCAGCACTGG - Intergenic
966314836 3:178633519-178633541 CCTCCAGCCTTGGCTACAAGGGG - Intronic
968013891 3:195309252-195309274 CCACCGTGCCTGGCCACAAGTGG - Intronic
968179390 3:196580495-196580517 CCACCATGCCTGGCGAGACGGGG + Intronic
968319803 3:197755773-197755795 TCACCATGCCTGGCCGGAAGGGG + Intronic
968401269 4:300173-300195 CCACCATGCCTGGCCACAAATGG - Intronic
969695375 4:8731309-8731331 CCACCATGCCCAGCCAGAAGTGG + Intergenic
969700994 4:8767780-8767802 CCACCGTGCCTGGCTGGATGTGG + Intergenic
973168668 4:47111574-47111596 CCACCATGCTTGGCCTGCAATGG - Intronic
975100405 4:70506713-70506735 GCACCATGCTTGGCTCCTAGTGG - Intergenic
976399695 4:84593789-84593811 CCACCGTGCTGGCCTACAAGTGG + Intronic
976607614 4:86997197-86997219 CCACCACGCTTGGCCTGAACTGG + Intronic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978714595 4:111826076-111826098 CCACCATGCCCGGCTAATAGAGG + Intergenic
979320408 4:119316649-119316671 CCACCCTGCTTGGCCAAAAGAGG - Intergenic
981576886 4:146214829-146214851 CCACCATGCTCAGCTCCAAGTGG + Intergenic
982272750 4:153607958-153607980 CCACCATGCCTGGCTACATTTGG - Intronic
982664610 4:158245990-158246012 CCACCATGCCTGGCTAGAAGGGG - Intronic
984181887 4:176493816-176493838 CCACCATGCCTGGCTAGTTTTGG - Intergenic
984734046 4:183094252-183094274 CCACCACGCTTGGCCAGCAGTGG + Intergenic
987735518 5:21838270-21838292 CCACCATGCCTGGCCAGCACTGG - Intronic
988447339 5:31302433-31302455 CCACCATGCCCGGCCAGAACTGG - Intronic
989037649 5:37192575-37192597 CCACCGTGCCTGGCCAGATGAGG - Intronic
989105487 5:37859123-37859145 CCACCATCCCTGGCCAGAAGAGG - Intergenic
989594440 5:43142981-43143003 CCACCATACTTGGCCAGACATGG + Intronic
990332906 5:54745160-54745182 CCACCATGCCTGGCCAGACTAGG + Intergenic
993848047 5:92970038-92970060 CCACTATGCTTTGCTTGAATTGG + Intergenic
994611745 5:102049817-102049839 TCACCATGCCTGCCTAGATGGGG - Intergenic
995438195 5:112160828-112160850 CCACAATGCTTTTCTACAAGTGG - Intronic
996577336 5:124990277-124990299 CCACCATGCCTGGGCAGAAATGG - Intergenic
997150189 5:131485212-131485234 CCACCATGCTTGGCTAGAAGTGG + Intronic
997181221 5:131831260-131831282 CCACCATGCCTGGCCAAAAGAGG - Intronic
997248189 5:132369596-132369618 CCAGCAGGCTTGGCTGGCAGAGG + Intergenic
997313807 5:132915049-132915071 CCACCGTGCCTGGCCAGAAATGG - Intronic
997333199 5:133082846-133082868 CCACCATGCCTGGACAGTAGAGG - Intronic
997360607 5:133292318-133292340 CCACCAGGCCTGCCTGGAAGGGG + Intronic
997451515 5:133987388-133987410 CCACCACGCCTGGCTACAAATGG - Intronic
997574251 5:134961569-134961591 CCACCGCGCTTGGCCAGAAGTGG + Intronic
997733709 5:136198600-136198622 ACTCCATGCTTGGCTAGCAAGGG - Intergenic
998248583 5:140532943-140532965 CCACCATGCCTGGCTAAATTCGG - Intronic
999015863 5:148104606-148104628 CCACCGTGCCTGGCCAGAAATGG - Intronic
999057170 5:148590447-148590469 CCACCATGCTTGGCTAATTTTGG + Intronic
999877041 5:155818806-155818828 CCGCCATGCTTGGCTGGGAATGG + Intergenic
1000324950 5:160165180-160165202 CCACTATCCTAGTCTAGAAGAGG + Intergenic
1000332188 5:160214591-160214613 CCACCATGCCTGGCCTCAAGTGG + Intronic
1001326134 5:170726610-170726632 CCACCATGCCTGACTGGAATGGG - Intronic
1001921293 5:175602035-175602057 CCACCATGCCTGGCTACCATAGG + Intergenic
1002109890 5:176901446-176901468 CCATCATGCTTGGCCAGCCGTGG - Intergenic
1003244246 6:4370765-4370787 CCACCGTGCCTGGCCAGAAGAGG + Intergenic
1004163273 6:13233197-13233219 CCACCATGATTAGCTAGCAAAGG + Intronic
1004270170 6:14188216-14188238 CCACCATGCCTGGCTAAGAATGG + Intergenic
1004331370 6:14724992-14725014 CCACCAAGCTTGGCTGAAATTGG - Intergenic
1004623277 6:17350125-17350147 CCACCGTGCCCGGCCAGAAGAGG + Intergenic
1004945777 6:20610960-20610982 CCACCACGCCTGACTAGAATGGG + Intronic
1005719728 6:28589575-28589597 CTTTCATGCTTGGATAGAAGGGG - Intronic
1005783398 6:29217529-29217551 GCTCCATCCTTGGCTAAAAGAGG + Intergenic
1006071848 6:31503995-31504017 CCACCCTGATTGGTTTGAAGTGG + Intronic
1006265876 6:32923076-32923098 CCACCATGCCTGGCCTGAACTGG - Intergenic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010687525 6:78869954-78869976 CCACCATGCTTGGCTAATTTTGG - Intronic
1010745085 6:79551800-79551822 CCACCATGCTTGGCCTGAAAAGG - Intergenic
1011425692 6:87226965-87226987 CCACCATGCCTGGCTTTAATGGG + Intronic
1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG + Intergenic
1013243454 6:108267016-108267038 CCACCATGCTCAGCCAGGAGTGG - Intergenic
1013332912 6:109123779-109123801 CCACCATGCCTGGCCAGAAGTGG - Intronic
1014228514 6:118875481-118875503 CCACCATGCCTGGCTAGTTTTGG - Intronic
1014915876 6:127147263-127147285 CCTCCAAGCTTAGTTAGAAGAGG - Intronic
1015370917 6:132451381-132451403 CCACCCCTCTTGGCTGGAAGTGG + Exonic
1016426676 6:143942492-143942514 ACACCATGCTGGGCTATAAGAGG - Exonic
1016960639 6:149669418-149669440 CCACCGTGCCTGGCTGGATGAGG + Intronic
1017006706 6:150032626-150032648 CCACCAGGCCTGGCCAGGAGGGG + Intergenic
1019092005 6:169545406-169545428 CCACCAGGCTTGGCTGGATGAGG - Intronic
1019529381 7:1495903-1495925 CCCCCATGCTGGGCCAGAACTGG + Intronic
1020293307 7:6739263-6739285 CCACCATGCTAGGCCTGAGGAGG - Intergenic
1021518452 7:21512848-21512870 CCACCATGCCCGGCTAGGAAAGG + Exonic
1022204641 7:28151390-28151412 CCACCATACCTGGCTTGGAGGGG + Intronic
1025188498 7:56879236-56879258 CCACCATGCCTGGCCAGAAAAGG + Intergenic
1025683431 7:63697684-63697706 CCACCATGCCTGGCCAGAAAAGG - Intergenic
1026114791 7:67487069-67487091 CCACCACGCCTGGCCAGGAGTGG + Intergenic
1026273497 7:68856853-68856875 CCACCATGCTCAGCTACAATGGG - Intergenic
1026313270 7:69206764-69206786 CCACCATGCTTGGCTAATTTTGG - Intergenic
1026777432 7:73239392-73239414 CCACCAAGCCTGGCCAGGAGAGG - Intergenic
1026867032 7:73830335-73830357 CTTCTCTGCTTGGCTAGAAGAGG - Exonic
1026944960 7:74309909-74309931 CCACCATGCCTGGCCCAAAGTGG - Intronic
1026976535 7:74502224-74502246 CCACCATGCCCGGCCAGAAAGGG + Intronic
1027018283 7:74792764-74792786 CCACCAAGCCTGGCCAGGAGAGG - Intergenic
1027047720 7:75002211-75002233 CCACCATGCCTGGCCAGGAAAGG + Intronic
1027069744 7:75153154-75153176 CCACCAAGCCTGGCCAGGAGAGG + Intergenic
1027192401 7:76004414-76004436 CCACCATGCTTGGCCAAGATAGG - Intronic
1028277836 7:88879749-88879771 CCACCATGCCTGCCTTCAAGTGG - Intronic
1029071655 7:97904333-97904355 CCACCATGATTGGTCAGAATAGG + Intergenic
1030001475 7:105068602-105068624 CCACCATGCCTGACTAGTTGTGG + Intronic
1030082642 7:105790969-105790991 CCACGATCCTAGGCCAGAAGAGG + Intronic
1030168670 7:106579928-106579950 CCACCATGCTGGCCCAGATGAGG - Intergenic
1030824879 7:114142858-114142880 CCACCATCCGTGGTCAGAAGTGG - Intronic
1032599391 7:133277112-133277134 CCACCACGCCTGGCTATAACTGG + Intronic
1032756743 7:134898075-134898097 CCACCATGCCTGGCTAGCCTGGG + Intronic
1033073632 7:138227816-138227838 CCACCATGCCTGGCTAAGAAAGG - Intergenic
1033805811 7:144953298-144953320 CCTCCATGCTACCCTAGAAGAGG + Intergenic
1034904286 7:154930192-154930214 CCACCATGCCTGGCTGAAATTGG + Intronic
1035960287 8:4128921-4128943 CCACCATGCCCGGCTAAAACAGG - Intronic
1036246051 8:7117663-7117685 CCACCATGATTGGTCAGAATAGG - Intergenic
1036254748 8:7196800-7196822 CCACCATGATTGGTCAGAATAGG + Intergenic
1036362740 8:8090707-8090729 CCACCATGATTGGTCAGAATAGG - Intergenic
1036522292 8:9502798-9502820 CCACCATGCCTGGCTATCTGTGG + Intergenic
1036895816 8:12634464-12634486 CCACCATGATTGGTCAGAATAGG + Intergenic
1039003481 8:33007793-33007815 CCACCATGCCCAGCTAGAGGTGG - Intergenic
1039522685 8:38184689-38184711 ACACTATGCTAGGCTAGAGGAGG - Intronic
1040392893 8:46964539-46964561 CCACCATGCTGGGATACAAGGGG - Intergenic
1042351974 8:67786386-67786408 TCACCATGCTTGGCCAGATGTGG - Intergenic
1042496967 8:69466248-69466270 CCAACATTCTTGGCAAGGAGGGG - Intergenic
1043613287 8:82092569-82092591 CCACCATGCCTGGCCTGAATGGG - Intergenic
1044139630 8:88634767-88634789 CCACCATGCCTGGCGTGATGTGG - Intergenic
1047255948 8:123213513-123213535 CCACCACGCCCGGCCAGAAGTGG - Intergenic
1047878476 8:129166868-129166890 TAAGCATGCTTGGCTACAAGTGG + Intergenic
1048942426 8:139413255-139413277 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
1049856638 8:144866256-144866278 CCACCATGCCTGGCCAGGAATGG + Intergenic
1049863202 8:144914953-144914975 CCACCATGCCTGGCCACCAGGGG + Intergenic
1050362672 9:4845573-4845595 CCCCTATACTTGGTTAGAAGAGG + Intronic
1050468427 9:5958480-5958502 CCACCACACTTGGCTTAAAGTGG - Intronic
1051504617 9:17813589-17813611 CCACCATGCCTGGCCAGGACAGG - Intergenic
1051607497 9:18929791-18929813 CCAGCTCACTTGGCTAGAAGTGG + Intronic
1051792303 9:20819499-20819521 CCACCATGCTTGGCAAGGCAGGG + Intronic
1052310061 9:27057568-27057590 CCACCGTGCCTGGCCAAAAGAGG - Intronic
1052645666 9:31230412-31230434 CCACTTTGCTTGGCTAGGAAAGG + Intergenic
1052696856 9:31889050-31889072 CCACTTTGCTTGGCTAGGAAAGG + Intergenic
1052965974 9:34340962-34340984 CCACCACGCCTGGCCAGAAGCGG + Intronic
1054895991 9:70311968-70311990 CCACCATGCTAGGCTAATACAGG - Intronic
1056180835 9:84080628-84080650 CCACCACGCTGGGCTGGAACTGG + Intergenic
1056805636 9:89726673-89726695 CCACCACGCCTGGCAAGAATAGG + Intergenic
1057890845 9:98868582-98868604 CCACCATGCCTGGCCAGTTGTGG + Intergenic
1057995207 9:99816728-99816750 CCACCATGCCTGGCTGGAATAGG - Intergenic
1058120596 9:101134669-101134691 CCACCACACATGGCTAGAACAGG + Intronic
1058345464 9:103955729-103955751 CCACCACGCCTGGCTGGATGGGG + Intergenic
1059487550 9:114638327-114638349 CCACCATGCCTGGTTATAAAAGG + Intronic
1060121612 9:120996104-120996126 CCACTGTGCCTGGCCAGAAGTGG + Intronic
1060658082 9:125386645-125386667 CCACCATGCCTGGCCTGGAGTGG - Intergenic
1060908673 9:127331199-127331221 CCACCATGCCCGGCCAGTAGTGG - Intronic
1061303895 9:129721866-129721888 CCACCACGCTTGGCCCCAAGGGG + Intronic
1062072343 9:134563388-134563410 CCACCATGCCTGGCTACACTGGG + Intergenic
1185691142 X:2156118-2156140 CCACCATGCCTGGCCTCAAGGGG - Intergenic
1185714971 X:2334315-2334337 CCACCATGCCTGGCTAATATTGG + Intronic
1187163084 X:16782181-16782203 CCACCGTGCCTGGCCAGAAATGG + Intergenic
1187326984 X:18300024-18300046 CCACTATGCCTGGCCAGAAAAGG + Intronic
1187343004 X:18438349-18438371 CCACCATGCCTGGCCTGAAGAGG + Intronic
1187649440 X:21385700-21385722 CCACCTTGCTTTTCTAGCAGAGG + Intronic
1188315269 X:28665776-28665798 CCACCATGCCCGGCTATAAGTGG + Intronic
1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG + Intergenic
1190866492 X:54389219-54389241 CCACCATGCCTGGCTAGGGGTGG - Intergenic
1190992408 X:55566049-55566071 CCACCTTCCTTGGCTAGGGGAGG - Intergenic
1191171165 X:57448256-57448278 CCACCATGCTCAGCTATAATGGG + Intronic
1194659486 X:96614130-96614152 CCACCGTGCCTGGCCAGTAGTGG - Intergenic
1196417300 X:115484976-115484998 CCACCATGCTTAGCTATATTTGG + Intergenic
1196895961 X:120335851-120335873 TCACCGTGCCTGGCTAGATGTGG + Intergenic
1197046886 X:122008355-122008377 CCACCATGCCTAGCTAGGACAGG + Intergenic
1197200896 X:123747665-123747687 CCACCATGCCTGGCCATAAAAGG + Intergenic
1198227654 X:134660391-134660413 CCACCATGCCTGGCCGAAAGAGG + Intronic
1200986710 Y:9308688-9308710 CCACCAAGCTTGGCTAGCTTTGG - Intergenic
1201076291 Y:10192226-10192248 CCACTATGCTTACCTAGATGGGG - Intergenic
1201294313 Y:12450658-12450680 CCACCATGCCCGGCCAAAAGTGG + Intergenic
1202118979 Y:21505117-21505139 CCACCAAGCTTGGCTAGCTTTGG + Intergenic
1202121431 Y:21528657-21528679 CCACCAAGCTTGGCTAGCTTTGG + Intronic
1202123875 Y:21552231-21552253 CCACCAAGCTTGGCTAGCTTTGG + Intergenic
1202155133 Y:21877149-21877171 CCACCAAGCTTGGCTAGCTTTGG - Intergenic
1202157572 Y:21900725-21900747 CCACCAAGCTTGGCTAGCTTTGG - Intronic
1202160022 Y:21924262-21924284 CCACCAAGCTTGGCTAGCTTTGG - Intergenic
1202184020 Y:22165649-22165671 CCACCAAGCTTGGCTAGCTTTGG - Intergenic
1202207339 Y:22420752-22420774 CCACCAAGCTTGGCTAGCTTTGG + Intergenic