ID: 997150552

View in Genome Browser
Species Human (GRCh38)
Location 5:131489915-131489937
Sequence CTTTGTAAACCATCTGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997150552_997150556 -5 Left 997150552 5:131489915-131489937 CCCACACCAGATGGTTTACAAAG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 997150556 5:131489933-131489955 CAAAGGAAAACATTTAATCATGG 0: 1
1: 0
2: 4
3: 62
4: 775

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997150552 Original CRISPR CTTTGTAAACCATCTGGTGT GGG (reversed) Intronic
900484593 1:2915446-2915468 CTCTGGAAACCTTCCGGTGTGGG + Intergenic
900857617 1:5198607-5198629 CTTGGTAACACCTCTGGTGTCGG - Intergenic
915971186 1:160356343-160356365 CTTGGGTAAGCATCTGGTGTGGG + Exonic
917011851 1:170483438-170483460 GTTTGTAACACATCTGGTGTCGG + Intergenic
919739952 1:200975380-200975402 CTGTGAAAACCATCTGGCCTGGG + Intronic
922862722 1:228833058-228833080 CTTTGTACATCACCTGGTGAGGG - Intergenic
923366079 1:233263055-233263077 CTTTGTCAAACATGAGGTGTAGG + Exonic
1068193114 10:53679891-53679913 TTTTGCAAACCATATGGTTTTGG + Intergenic
1068362821 10:56001383-56001405 CTTTTTAAAGAATCTGGTTTAGG - Intergenic
1070975819 10:80604688-80604710 CTTTTTAAACCTTCTGGTTTGGG - Intronic
1071754181 10:88517813-88517835 CTCTCCAAACCTTCTGGTGTTGG - Intronic
1072773931 10:98170274-98170296 CTTTGAAAATCATCTGGTTGAGG - Intronic
1073589405 10:104742302-104742324 ATTTGTAATCCATTTGGTGCTGG + Intronic
1074834741 10:117279451-117279473 CTTTATAAACCAAATGTTGTTGG + Exonic
1075053615 10:119201771-119201793 CTTTGTAACACATCTACTGTGGG + Intergenic
1079514486 11:21250922-21250944 ATTTGTAAACCATATGGACTGGG + Intronic
1080503449 11:32891591-32891613 CTTTGGTAATAATCTGGTGTTGG - Intergenic
1080603899 11:33847998-33848020 CTTTTTTAACCATCTTGTGCAGG - Intergenic
1081659393 11:44878589-44878611 CTTTGTATACCCTCTGGTTCAGG - Intronic
1083126279 11:60569470-60569492 CTTTGTAAATAATATGCTGTTGG - Intergenic
1088242080 11:107783239-107783261 CTTAGGCAACCATCTGGTGATGG - Intergenic
1088347793 11:108848740-108848762 TTTTAAAAACCATATGGTGTTGG + Intronic
1089169762 11:116503851-116503873 CTTTGGAAGCCATCTGGGATAGG + Intergenic
1090583532 11:128185375-128185397 CTTTGTAAATTACCTGGTCTTGG + Intergenic
1091848821 12:3678816-3678838 ATTTGTTAACCATGTGGTGCTGG - Intronic
1092683776 12:11017973-11017995 TTCTGTAACCCATCTGGTTTTGG - Intronic
1092688093 12:11073621-11073643 TTCTGTAACCCATCTGGTTTTGG - Intronic
1092689164 12:11087751-11087773 TTCTGTAATCCATCTGGTTTTGG - Intronic
1093373971 12:18400927-18400949 TTTTGTAAGCCTTCTTGTGTGGG + Intronic
1095374151 12:41506230-41506252 CTTTATAAAGTATCTGGAGTTGG - Intronic
1096940539 12:55340074-55340096 CTTTATCAACCATCTGTTGATGG + Intergenic
1097560427 12:61198372-61198394 ATTTTTAAACCATCTAGTTTTGG + Intergenic
1100222638 12:92522409-92522431 CTTTATAAATCACCCGGTGTTGG + Intergenic
1102800976 12:115733585-115733607 CTTTGAGAAGCATCTTGTGTGGG + Intergenic
1104862754 12:131933000-131933022 CCTTGTAAACCATCAGATCTTGG + Intronic
1108617702 13:52150299-52150321 CTTAGTAATCCCTCTGTTGTTGG - Intronic
1110791519 13:79591492-79591514 CTTTATAAACTATCTGTGGTTGG + Intergenic
1111030218 13:82587532-82587554 CTAAGGAGACCATCTGGTGTAGG + Intergenic
1111249778 13:85588431-85588453 CTATGTATACAATGTGGTGTGGG - Intergenic
1113942862 13:114027595-114027617 ATTTGCATACCATCTGGAGTTGG - Intronic
1114166544 14:20224439-20224461 CTTTGTATTCCCTCTGGTGCTGG + Exonic
1119147747 14:72332220-72332242 GTTTGTGAACCATCTGGAGCTGG - Intronic
1119904801 14:78292003-78292025 ATTTGAAAACCATCTGAGGTGGG + Intronic
1121731960 14:96193537-96193559 CTTTCTGAATCATCTGGTCTGGG + Intergenic
1122578050 14:102754293-102754315 CTTGGAAATCCATCTGGTGGCGG + Intergenic
1123695834 15:22878529-22878551 GTTTGTAATCCTTCTGGAGTTGG - Intronic
1125976669 15:43959608-43959630 CTTTGGTAATCATCTGGTCTAGG - Intronic
1126232095 15:46339058-46339080 CTTTATAAATCACCTAGTGTCGG + Intergenic
1126391659 15:48162336-48162358 ATATGTAAACCATTTAGTGTTGG - Intronic
1129425608 15:75460333-75460355 CTTTGTGAACCAACTGGTATAGG + Intergenic
1130173475 15:81542936-81542958 CTTTGCAAACAATGTGGAGTCGG - Intergenic
1130715150 15:86326322-86326344 CTCTCTTAGCCATCTGGTGTGGG + Intronic
1130933706 15:88450906-88450928 ATTTGTAATCCATCTGGAGAGGG + Intergenic
1131606753 15:93913153-93913175 ATTTGGAAACCATTTGATGTAGG - Intergenic
1131608050 15:93930107-93930129 CTTATAAAATCATCTGGTGTAGG - Intergenic
1134413820 16:14026310-14026332 CTTTGTAAAAAATCAGTTGTGGG - Intergenic
1134541165 16:15066926-15066948 ATTTGTGAACCATCTGGTCCAGG - Intronic
1135436623 16:22431470-22431492 ATTTGTGAACCATCTGGTCCAGG - Intronic
1135900089 16:26449942-26449964 CTTTGTAGACTCTCTGGTGATGG + Intergenic
1136263636 16:29100447-29100469 ATTTGTGAACCATCTGGTCCAGG + Intergenic
1138254093 16:55537723-55537745 ATTTGTAAAACACCTGGTGATGG - Intronic
1139214984 16:65119126-65119148 CTTTGTAAAGATTCTGGTTTGGG - Intronic
1148324255 17:46773979-46774001 CTTTGTGAACCCTCCGGGGTAGG + Intronic
1152011455 17:77721306-77721328 CGTTCTAAACCCTCTTGTGTCGG - Intergenic
1152503527 17:80730036-80730058 CTTTGGCAGCCACCTGGTGTGGG + Intronic
1153756991 18:8294277-8294299 CTTTATAAACTACCTGGTTTTGG - Intronic
1156652450 18:39240097-39240119 CTTTGAAAGGCGTCTGGTGTGGG + Intergenic
1158910964 18:62062005-62062027 CTCTGTGAACCATGTGGTGCTGG - Intronic
1159194566 18:65096005-65096027 CTTTGTAAATTATCCGGTCTCGG + Intergenic
1159643452 18:70889509-70889531 CTTTGTAAATTACCTGGTCTTGG + Intergenic
1166137247 19:40785202-40785224 CCTTGCAAACCTTTTGGTGTGGG - Intronic
927593440 2:24376511-24376533 CATTGTTAACCTTTTGGTGTGGG + Intergenic
927764260 2:25790615-25790637 TTTTGAAAACCATTTGTTGTAGG - Intronic
930158249 2:48127342-48127364 CTTTGTAAACCATATGAAGAAGG + Intergenic
930206955 2:48597272-48597294 CTTTCTTTATCATCTGGTGTGGG + Exonic
932136581 2:69235844-69235866 CTTTATAAATTATCTGGTCTTGG - Intronic
933491799 2:82993964-82993986 CTTTGTAAGCCATTTTCTGTGGG - Intergenic
937563564 2:123256121-123256143 TTTTGTAAACCATCTGAAATGGG + Intergenic
938894547 2:135737284-135737306 CATTCTAAACAATCTGGGGTGGG - Intergenic
940385304 2:153064527-153064549 CTATATAGACCACCTGGTGTAGG - Intergenic
943592280 2:189813220-189813242 CTTTGGAAACCATTGGATGTTGG + Intronic
943733762 2:191331295-191331317 AGTTATAAACCACCTGGTGTAGG + Intronic
945044810 2:205772541-205772563 CTTTGTAGAGAATCTGGGGTGGG + Intronic
946097914 2:217291592-217291614 CCTTGTCAAACATCTGGTGAGGG - Intronic
1168959173 20:1856821-1856843 CTTTGCCTCCCATCTGGTGTTGG - Intergenic
1172490485 20:35332657-35332679 CTTTGTAACCTGTCTGGTGTGGG - Intronic
1172962600 20:38809058-38809080 CTCAGTACAGCATCTGGTGTGGG + Intronic
1175806570 20:61832462-61832484 CTTTGTAAACTATCCAGTCTTGG - Intronic
1176922422 21:14704134-14704156 CTCTCTAAACCATGTGATGTAGG + Intergenic
1177557465 21:22710820-22710842 CTTTGCTAACCAACTGATGTAGG + Intergenic
1180057406 21:45366015-45366037 CTCTGTAAACCAGGCGGTGTTGG + Intergenic
1183895655 22:40966453-40966475 TTTTCTTAACCATCAGGTGTTGG - Intronic
950231411 3:11279140-11279162 CTTTCTCAACCATCAGGGGTGGG + Intronic
951140935 3:19158787-19158809 CTTTGTAATAATTCTGGTGTTGG + Intronic
952178610 3:30894457-30894479 CTTTGTAAAGCGGCTGGGGTGGG - Intronic
958655486 3:96997070-96997092 CCTTGTGAACCAACTGCTGTTGG + Intronic
958988533 3:100812914-100812936 CTTTGTCAACCAGATGGAGTAGG + Intronic
964869422 3:161297000-161297022 CTGTGGGAGCCATCTGGTGTTGG - Intergenic
971455909 4:26843716-26843738 CTTTGTAAATTACCTGGTCTAGG - Intergenic
975017143 4:69436317-69436339 CTTTGTAAATCATCAGATATGGG + Intergenic
975703888 4:77092654-77092676 GTTTGTAGACCATCTGGACTAGG + Intergenic
975784510 4:77873632-77873654 CTTTGTTGAGCATCTGCTGTAGG + Intronic
978399516 4:108315849-108315871 CTTTGTCACCCATCAGCTGTTGG + Intergenic
979161732 4:117470151-117470173 CTTTGTGAACAACCTGGTCTAGG - Intergenic
980718898 4:136667001-136667023 ATTTGTAAATCATCTGATGAGGG + Intergenic
981148495 4:141353627-141353649 CTTTTTAAACTCTCTGGAGTTGG - Intergenic
985372775 4:189303528-189303550 GTTTCTAAAGAATCTGGTGTCGG - Intergenic
986189918 5:5486573-5486595 CATTGTATATCATCTGGTATAGG + Intronic
991493106 5:67202346-67202368 ATTTGAAAACTATCTGGTGTTGG + Intergenic
992209830 5:74467927-74467949 CATTATAAACCCTCTGGTGTGGG + Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
993869987 5:93241116-93241138 CTTTCCAAACTGTCTGGTGTAGG - Intergenic
997150552 5:131489915-131489937 CTTTGTAAACCATCTGGTGTGGG - Intronic
1000761564 5:165231773-165231795 ATATGTAAACTATCTGGAGTTGG + Intergenic
1001479779 5:172080456-172080478 CTTGGCTAACCGTCTGGTGTAGG - Intronic
1002436944 5:179237463-179237485 CTATGTAAGCCACCTGGTGTTGG + Intronic
1003180316 6:3785230-3785252 CTTTATAAATTATCTGGTCTCGG + Intergenic
1004303120 6:14476346-14476368 GTTTGTAAACCATCTTTTATTGG + Intergenic
1004608034 6:17212272-17212294 CTTTATAAATCATTTGTTGTTGG + Intergenic
1005155546 6:22801996-22802018 CCTGGTAACCCATATGGTGTTGG - Intergenic
1005782930 6:29212016-29212038 CTTTGTATAAGATCTGGTGTGGG - Intergenic
1008290647 6:49711758-49711780 CTTTGGAAACCATCAGGTCTGGG + Intronic
1008671363 6:53772483-53772505 CTATTTAAACCATGTGGTATAGG - Intergenic
1008901761 6:56627470-56627492 CTTTGAAAACCACATGGGGTGGG - Intronic
1011184199 6:84656296-84656318 TTTTGTAAGCCATTTGGTTTTGG - Intergenic
1011202367 6:84851379-84851401 CTTTTTAAAAGATCTGGTCTTGG + Intergenic
1016830875 6:148431946-148431968 CTTTGTACACTATCTAGTCTTGG - Intronic
1017965070 6:159257212-159257234 CCTTGTATGCCATCTGGTTTTGG + Intronic
1019364706 7:627461-627483 CTTTGCAAACCCTCAGGCGTGGG - Intronic
1022533777 7:31083276-31083298 CATTATAAACCATCGGGTGAAGG + Intronic
1028038745 7:86020056-86020078 CTTTATAAACCATCAGATATTGG + Intergenic
1029195819 7:98804535-98804557 CTTTGAAGACCAGCTGGTGCTGG - Intergenic
1031460604 7:122044284-122044306 TTTTGTAAGCAATCTTGTGTGGG + Intronic
1034059366 7:148072336-148072358 CTTTTTGAGCCATGTGGTGTCGG + Intronic
1034292295 7:149942466-149942488 CTTTGTAGAAGATCTGATGTGGG + Intergenic
1034492899 7:151403737-151403759 TTTTATAAACCCTCTGGGGTTGG - Intronic
1035009260 7:155698418-155698440 TTTTCTAAACCATATGGTGAAGG + Intronic
1035383969 7:158458229-158458251 CTTTGAAAACCACCAGATGTCGG - Intronic
1037369149 8:18155078-18155100 ATTTTTAATCCATCTGTTGTCGG - Intergenic
1039561675 8:38517300-38517322 CTGTATAAACGATCTGGGGTGGG - Intronic
1040567723 8:48582334-48582356 CTTTGGAAACCCGCTGGTGGTGG + Intergenic
1043912092 8:85875165-85875187 CTTTGTAAATCAGCAGGGGTGGG - Intergenic
1044559904 8:93602732-93602754 CTTTGGAAACCATCTCTTTTAGG - Intergenic
1044803739 8:95983555-95983577 CTTTCTGATCCCTCTGGTGTGGG - Intergenic
1044933263 8:97270395-97270417 CTTTGTAAACCATGAAGTGTTGG + Intergenic
1047716719 8:127602560-127602582 CTAGGGAAACCATCTGGTCTTGG - Intergenic
1048779265 8:137983588-137983610 CTTTGTGAACCATATCGTTTGGG + Intergenic
1051341462 9:16115867-16115889 CTTTATAAATCACCTGGTCTCGG - Intergenic
1057620830 9:96633187-96633209 TTTTGGAAACCATCTGTAGTTGG + Intergenic
1057914631 9:99046481-99046503 CTTTGTAAATTATCTAGTCTTGG - Intronic
1058771818 9:108241422-108241444 CTTTGAAAACCATGTGTTGAAGG - Intergenic
1059693291 9:116707201-116707223 CCTAGTAAACCATCTGCTTTTGG - Intronic
1185574492 X:1159117-1159139 CTTTATAAATTACCTGGTGTTGG - Intergenic
1186712612 X:12215972-12215994 CTTTGCAAGCCATGTGGTCTTGG - Intronic
1186842267 X:13495759-13495781 CTTTGTAAACCAGCTGAAGGAGG + Intergenic
1192124860 X:68492590-68492612 CTTTATAAACTACCTGGTCTCGG - Intergenic
1196167755 X:112554095-112554117 CTTTGTAAGCCATGAGCTGTGGG + Intergenic
1196377057 X:115044957-115044979 CTTTCTCTACCATCTGATGTTGG - Intergenic
1196969481 X:121093199-121093221 CTTTGCAAAACATCTTGTTTTGG + Intergenic
1199339924 X:146665558-146665580 TTTTGTAAACCATCTGGGCCTGG - Intergenic