ID: 997157798

View in Genome Browser
Species Human (GRCh38)
Location 5:131577436-131577458
Sequence ATATGGATGTACCTTCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 2, 1: 0, 2: 3, 3: 9, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997157795_997157798 15 Left 997157795 5:131577398-131577420 CCTCAAGAAGCTACAGGGTATAG 0: 3
1: 2
2: 10
3: 56
4: 249
Right 997157798 5:131577436-131577458 ATATGGATGTACCTTCTTGTTGG 0: 2
1: 0
2: 3
3: 9
4: 138
997157797_997157798 -9 Left 997157797 5:131577422-131577444 CCATTTGAACTTTTATATGGATG 0: 22
1: 32
2: 19
3: 43
4: 355
Right 997157798 5:131577436-131577458 ATATGGATGTACCTTCTTGTTGG 0: 2
1: 0
2: 3
3: 9
4: 138
997157793_997157798 20 Left 997157793 5:131577393-131577415 CCTGTCCTCAAGAAGCTACAGGG 0: 1
1: 9
2: 39
3: 158
4: 493
Right 997157798 5:131577436-131577458 ATATGGATGTACCTTCTTGTTGG 0: 2
1: 0
2: 3
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997157798 Original CRISPR ATATGGATGTACCTTCTTGT TGG Intronic
904103715 1:28057473-28057495 ATATGGGTTTATCTTCTTTTTGG - Intronic
904708390 1:32409463-32409485 ACATGGATGTGCCTACTTGAAGG - Intergenic
905096257 1:35473456-35473478 ATTTGCATGTACCTTTCTGTGGG - Intronic
907364629 1:53947634-53947656 ATATGGATGTAGCTCATTTTGGG + Intronic
908303904 1:62791340-62791362 ATATGGATGCACCTTTTTCTTGG + Intronic
908363293 1:63390984-63391006 TTATGAAGGTACTTTCTTGTGGG + Intronic
910111681 1:83690201-83690223 ATACGGAGGTACCCTCTTGCTGG + Intergenic
912146822 1:106804282-106804304 ATAGGGATGTAGCATCTTGAAGG + Intergenic
912632779 1:111261251-111261273 ATATGGATTTCCTTTCTTTTGGG + Intergenic
914387004 1:147179485-147179507 CTTTGGATTTAGCTTCTTGTTGG - Intronic
915830528 1:159125384-159125406 ATATGGACTTACATTCTAGTAGG - Intronic
916263834 1:162869626-162869648 CTATGGATGTAACTTCCTGTGGG - Intergenic
916286973 1:163118298-163118320 ATAATGATGTATCTTCTTGTGGG + Intronic
916530138 1:165648903-165648925 ATAAGGATTTACCATCTTGTTGG + Intronic
917936298 1:179870443-179870465 AAAAGGATGTACCATCTTTTTGG - Intronic
918922936 1:190738359-190738381 ATAATGATGTAACTTTTTGTAGG - Intergenic
922368938 1:224890631-224890653 ATATGGATGTACCTTCTTGTTGG + Intergenic
1065398744 10:25271680-25271702 AGATGGAGTTTCCTTCTTGTTGG + Intronic
1071668169 10:87580918-87580940 ATATGGATGTACATACGTGGGGG + Intergenic
1076978972 11:195350-195372 ACATGGGTGTACCTTTTTCTTGG - Intronic
1077051842 11:570095-570117 ATGTGGATATATCTTCTTTTTGG - Intergenic
1080402375 11:31947807-31947829 CTATGGATGTGGCTTCCTGTGGG - Intronic
1080997057 11:37616995-37617017 ATTTGGATGTATCTTTTGGTGGG - Intergenic
1082766680 11:57174271-57174293 AGATGCATGTACCTTTTTGAGGG - Intergenic
1083135552 11:60672048-60672070 ATATGTATGTAACGTATTGTTGG - Intergenic
1083559363 11:63660308-63660330 ATATGGAAGTACCTTTTAATAGG - Intronic
1086767258 11:90712150-90712172 ATATTGATTTACTTTCTTTTGGG + Intergenic
1087294286 11:96351713-96351735 ATCTGGATCAACCATCTTGTTGG - Intergenic
1088194562 11:107260621-107260643 GTATGGATGTATCTTGTTTTGGG - Intergenic
1090651599 11:128811088-128811110 AACTGGATGTTCTTTCTTGTTGG + Exonic
1100751161 12:97699484-97699506 ATATGGATCTATCTTTTTATGGG + Intergenic
1105630718 13:22162985-22163007 TTATGGATTTATCCTCTTGTAGG + Intergenic
1107095372 13:36529890-36529912 ATATGAATTTAGCTTCTTGTTGG + Intergenic
1107256747 13:38436613-38436635 ATATACATGTGCCTACTTGTGGG - Intergenic
1108451745 13:50573525-50573547 ATATGGGTGTACATACATGTGGG + Intronic
1110639949 13:77812005-77812027 ATATGTATGTACCATCTACTAGG - Intergenic
1111335437 13:86815580-86815602 ATATGAAGGTGCTTTCTTGTCGG - Intergenic
1115039237 14:28901614-28901636 ATTTGAATGTATCTTTTTGTGGG - Intergenic
1123152359 14:106195172-106195194 ATTTAGATAGACCTTCTTGTCGG - Intergenic
1125302223 15:38268313-38268335 CTAAGGATGTACCTCCGTGTTGG - Intronic
1125953091 15:43770549-43770571 CTTTGGATTTAGCTTCTTGTTGG - Exonic
1126914148 15:53446855-53446877 ATATGGAAGTACATTCTCCTGGG - Intergenic
1128780675 15:70356932-70356954 AAGGGGATGCACCTTCTTGTAGG + Intergenic
1129555637 15:76505748-76505770 ATATGGATCTCCTTTCTTTTGGG - Intronic
1130701604 15:86188740-86188762 ATCAAGATGTACCATCTTGTAGG - Intronic
1133698529 16:8287728-8287750 ATAAGGATGTTCCTTCAGGTGGG + Intergenic
1133920958 16:10152713-10152735 GTCTGGATGTACCATCTTTTAGG - Intronic
1134141886 16:11727284-11727306 ATATGTTTGTAACATCTTGTAGG - Intronic
1135411124 16:22235401-22235423 ATATGGATGTAGTGTCTTGATGG + Intronic
1135606706 16:23832111-23832133 ACATGGATGTACCTTCTTGGGGG - Intergenic
1135634368 16:24061457-24061479 ATCTGGAAGTGCCTTCCTGTGGG + Intronic
1135924617 16:26682248-26682270 ATATGGATCTACAATCTTTTAGG + Intergenic
1140296631 16:73715394-73715416 ATAAGGATGTAAATTATTGTTGG - Intergenic
1140686534 16:77438949-77438971 AAATGGATTTACCTCCTTGAAGG + Intergenic
1142466462 17:140168-140190 ACATGGGTGTACCTTTTTCTTGG - Intergenic
1144163118 17:12581301-12581323 GAATGGATGTACCTTATTTTGGG + Intergenic
1151869233 17:76825341-76825363 ATGTGGATGTAGCTTTTTGGGGG + Intergenic
1153126979 18:1805210-1805232 ATATGCATGCATCTTTTTGTAGG + Intergenic
1153577056 18:6532787-6532809 ATGTGGACTTACCTTCTTGGGGG + Intronic
1156465614 18:37346502-37346524 ATATGGATGGACCACCTAGTCGG + Intronic
1156782034 18:40862042-40862064 GTATGTCTGTACCTTCCTGTTGG + Intergenic
1157072565 18:44425128-44425150 ATATTGATTTCCCTTCTTTTGGG - Intergenic
1157212567 18:45756335-45756357 ATGTGGAAAGACCTTCTTGTTGG - Intergenic
1159178476 18:64869877-64869899 ATATTGGTGTATTTTCTTGTTGG + Intergenic
1159282360 18:66302940-66302962 GTATGTATGTTCCTTTTTGTGGG + Intergenic
1159743033 18:72196999-72197021 ATATGAATGTACCTTTTTTCTGG + Intergenic
1161388461 19:4009035-4009057 CAGGGGATGTACCTTCTTGTAGG + Intronic
1161744640 19:6048268-6048290 ATATGTTTATACTTTCTTGTGGG - Intronic
1161827190 19:6575944-6575966 ATATGGACGCACTTTCTTGCTGG + Intergenic
1162262721 19:9545820-9545842 ATATGGACATACCTTCTTGCTGG + Intergenic
1162287307 19:9748796-9748818 ATATGGACATACCTTCTTGCTGG + Intergenic
1162979856 19:14231602-14231624 ATATGAATGTACATTTTTGGAGG - Intergenic
1165289477 19:34871549-34871571 ATATGGATGCTCCTTCTTCCGGG - Intergenic
926289755 2:11519273-11519295 ATCTGGATGTTACTGCTTGTTGG + Intergenic
927178977 2:20430563-20430585 AAGTGGATGTCCCCTCTTGTCGG - Intergenic
930128412 2:47823131-47823153 ATATGTAAATACCTTATTGTTGG + Exonic
931081628 2:58779404-58779426 ATATGGATATATCATTTTGTGGG - Intergenic
935460073 2:103319711-103319733 ATATGGATGGAACATCTTATTGG + Intergenic
936959548 2:118058653-118058675 CAAGGGATGTACCTTCTAGTGGG + Intergenic
937995130 2:127688296-127688318 ATATGCATGTAACTTTTTATGGG - Intergenic
942423300 2:175831369-175831391 AAATGGAAGTACATTGTTGTAGG + Intergenic
943743665 2:191438465-191438487 TCATGGAGTTACCTTCTTGTAGG - Intergenic
944140090 2:196446772-196446794 ATGTGGTTATTCCTTCTTGTTGG - Intronic
944253503 2:197600731-197600753 TTTTGGATGAACCTTTTTGTAGG - Intronic
945163529 2:206918464-206918486 AGATGGATGTATCTTCATGAAGG - Intergenic
945289232 2:208111422-208111444 ATATGTATGTATCTTCTTTAGGG + Intergenic
1174346599 20:49935085-49935107 AAATGAATGTACTTTGTTGTTGG + Intergenic
1177181178 21:17746184-17746206 ATAAGGATGTTCCTTCCTGTGGG + Intergenic
1179711550 21:43266415-43266437 ATGTGGATTTACCTTCCTGGGGG + Intergenic
949093659 3:60406-60428 ATATGGACATATCTTTTTGTGGG - Intergenic
952065961 3:29570810-29570832 ATATTGATTTTCCTTCTTTTGGG + Intronic
952162755 3:30710824-30710846 ATAAGGATGTTCCTTCCTCTGGG + Intergenic
955108885 3:55928092-55928114 ATATGGATTTCCTTTCTTTTGGG + Intronic
955401206 3:58592834-58592856 ATATGGACGCACTTTCTTGCTGG + Intronic
958535467 3:95397895-95397917 TTATGTATGTACCTACCTGTTGG + Intergenic
959722223 3:109505094-109505116 CTATGGATGTGGCTTCCTGTGGG + Intergenic
963352546 3:144169825-144169847 ATATGGTTATACCATCTTTTGGG - Intergenic
963411760 3:144937331-144937353 ATATAGATTTTCTTTCTTGTTGG - Intergenic
963485240 3:145927726-145927748 ATGTAAATGTACCTTCTTGAAGG - Intergenic
963962682 3:151326947-151326969 ATATGGATGTTACTGATTGTGGG + Exonic
968272761 3:197417202-197417224 ATATAGTTGTACCTTTCTGTTGG + Intergenic
970819459 4:20196149-20196171 ATATGGACGTACCTTCCTGTTGG + Intergenic
971883838 4:32415827-32415849 ATATCCATGTTCCTACTTGTAGG - Intergenic
973179506 4:47251169-47251191 CTATGGATGTGGTTTCTTGTGGG + Intronic
973831006 4:54758761-54758783 AAATAGATATCCCTTCTTGTGGG - Intergenic
974916803 4:68187914-68187936 ATATGGAGGTACCATCTTCATGG + Intergenic
975285978 4:72620707-72620729 ATATGGATTTTCTTTCTTTTTGG - Intergenic
978432314 4:108645492-108645514 ATGTGGATAGACCTTCCTGTAGG - Intergenic
979142207 4:117191150-117191172 ATACTGATTTCCCTTCTTGTGGG + Intergenic
979616823 4:122752459-122752481 ATATTGATGTGCTTTCTTTTGGG - Intergenic
980714892 4:136615852-136615874 ATATGGATGCACCTTCTTTTTGG + Intergenic
980788272 4:137582684-137582706 AGATGGATGCATCCTCTTGTGGG + Intergenic
981375831 4:144014490-144014512 ATATGGATGAACTTTATTTTAGG + Intronic
981549618 4:145930503-145930525 AAATGCATGGACCTTCTTGGAGG - Intronic
981901094 4:149864638-149864660 ATATGGATTTCCTTTCTTTTGGG - Intergenic
987963223 5:24837614-24837636 ACATGGATGTACCTTCCCTTAGG - Intergenic
990865905 5:60379616-60379638 ATATGCATGGACATTATTGTAGG - Intronic
994877193 5:105439290-105439312 ATATTGATTTCCCTTCTTTTGGG - Intergenic
997157798 5:131577436-131577458 ATATGGATGTACCTTCTTGTTGG + Intronic
997609142 5:135200141-135200163 GTATGTATGTATATTCTTGTGGG + Intronic
997874080 5:137532782-137532804 ATGTGGATGTATCTTTTTGGGGG - Intronic
999826666 5:155280222-155280244 ATATAAATGTACCTCCTTCTGGG - Intergenic
999880605 5:155859710-155859732 GTATAGATGTACCTTATAGTTGG + Intergenic
1011168701 6:84479900-84479922 CTATGGATGTGGCTTCCTGTGGG - Intergenic
1011232075 6:85173634-85173656 ATATTGATTTCCCTTCTTTTGGG + Intergenic
1013791342 6:113840462-113840484 ATATGTATGTACTTTTTTTTTGG + Intergenic
1014917573 6:127170314-127170336 AAATAGATGTGCCTTATTGTTGG + Intronic
1020678502 7:11208059-11208081 CTATGCATGTAACTTCTTTTTGG + Intergenic
1024498781 7:50077898-50077920 ATATTGATTTCCTTTCTTGTGGG - Intronic
1026136380 7:67665164-67665186 ATATGGATATATCTTTTTGGGGG + Intergenic
1027919246 7:84371067-84371089 ACATGGATGTACATTCATATAGG + Intronic
1028103841 7:86854208-86854230 ATATGGCTGTACTTTCCAGTTGG - Intronic
1028361138 7:89967570-89967592 AAATGGATGTGTCTTCTTGCAGG + Intergenic
1030315231 7:108107354-108107376 AAATGGGTGTTCCTTCTTCTGGG + Intronic
1031589539 7:123572547-123572569 AGATTGATGTATCTTCTTGGTGG + Intronic
1036215218 8:6873873-6873895 ATATTGAGGTTCCTTCCTGTTGG + Intronic
1038860738 8:31386753-31386775 ATATTGATTTCCCTTCTTTTGGG - Intergenic
1039320710 8:36427465-36427487 ATTTGGATGCACCTTATTTTTGG - Intergenic
1039451049 8:37675368-37675390 ATCTGGCTGTTCCTTCTTGACGG - Intergenic
1046393221 8:113604096-113604118 AAATGAATGTAGCTTCATGTTGG + Intronic
1048417987 8:134248490-134248512 AAATGGATTTACTTTCTTTTGGG - Intergenic
1048652733 8:136497425-136497447 AAATGTAATTACCTTCTTGTGGG + Intergenic
1051581646 9:18682224-18682246 ATACGGATGTACCTGCTTAAAGG + Intronic
1052734779 9:32330296-32330318 ATATTGATTTACTTTCTTTTGGG - Intergenic
1053333492 9:37239326-37239348 ATATTGATTTTCCTTTTTGTTGG + Intronic
1056003675 9:82243881-82243903 ATATGGACGTTCTTTCTTTTAGG + Intergenic
1056237851 9:84613585-84613607 ATATGGATGTACCCTACTGATGG + Intergenic
1060060886 9:120458502-120458524 TTATGAATGCACCTTCTTCTAGG + Exonic
1192764033 X:74124582-74124604 ATACGGATGTACTTTCTTGCTGG - Intergenic
1194942229 X:100024899-100024921 ATATTGATTTCCCTTCTTTTGGG - Intergenic
1200089244 X:153626626-153626648 ATATGGATGTATCTTTCAGTGGG - Intergenic
1201739772 Y:17311533-17311555 ATATTGATGTTCCTTCTAATAGG - Intergenic