ID: 997161169

View in Genome Browser
Species Human (GRCh38)
Location 5:131610714-131610736
Sequence GAAGAATTATAGCCCCTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
997161169_997161174 11 Left 997161169 5:131610714-131610736 CCATACAGGGGCTATAATTCTTC 0: 1
1: 0
2: 1
3: 2
4: 89
Right 997161174 5:131610748-131610770 TCTTGTCTAAGTTTCTTCTCAGG 0: 1
1: 1
2: 1
3: 22
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997161169 Original CRISPR GAAGAATTATAGCCCCTGTA TGG (reversed) Intronic
913282783 1:117201612-117201634 CAAGAGATATAGCCCCTTTATGG + Intronic
922455634 1:225771436-225771458 TAAGAAATATAGCCCCTCCAAGG - Intergenic
1073997540 10:109333068-109333090 GAAGCATTATAAACCCTGCAAGG + Intergenic
1075336899 10:121615266-121615288 AAAGAATTATGGCCCCTGGAAGG - Intergenic
1078592904 11:12660874-12660896 GAAGAATTAGATACCCTGAATGG - Intergenic
1081537890 11:44008463-44008485 GAAGAAGGACAGCCCCTGTGGGG - Intergenic
1081542258 11:44044372-44044394 GAAGAATTACTTCCCCTGTCTGG - Intergenic
1087640208 11:100748432-100748454 GAAGATTTAGATCCCCTGTTAGG + Intronic
1088239961 11:107763370-107763392 GAAGAATTAGATACCCTGAACGG + Intergenic
1092464982 12:8723211-8723233 GAACACTTAGAGCCACTGTAGGG + Intronic
1094850423 12:34379903-34379925 GAAGCATTATCGCCCTTGTGTGG + Intergenic
1099770142 12:87042010-87042032 AAAGAATTTTAGCCCCTCTTCGG - Intergenic
1100619680 12:96259061-96259083 GAAGAATTAAAGCCCCTTTATGG + Intronic
1107250870 13:38361151-38361173 AAAGAATTATGGACCCTGGATGG + Intronic
1107898888 13:44992659-44992681 GAAAATTTTTTGCCCCTGTAAGG + Intronic
1108123564 13:47215903-47215925 AAAGAATTAAAGTCCCTGGAGGG - Intergenic
1110300819 13:73924628-73924650 GAACACTTATAGCCATTGTAGGG - Intronic
1111021683 13:82459250-82459272 TAAGATTTAAATCCCCTGTAAGG - Intergenic
1114488521 14:23080181-23080203 GAAGAAATAGAGCCCATGGAAGG - Exonic
1118176385 14:63444289-63444311 GAATGATTATAGCCTCAGTAGGG - Intronic
1128704207 15:69826924-69826946 GATGAATTATGTCCCCTGGAGGG + Intergenic
1130121545 15:81052983-81053005 GAAGAAATAGAACCCCTGAACGG - Intronic
1135051712 16:19198529-19198551 GAATAATAATAGCCCCTGGGTGG - Intronic
1137041736 16:35619407-35619429 TAAGATTTAGAGCCCCTGTTAGG + Intergenic
1139195286 16:64911114-64911136 GAATAATTTTTGCTCCTGTATGG - Intergenic
1142394355 16:89823165-89823187 GAAGATTTACAGCCCCTCAAAGG + Intronic
1142637002 17:1264024-1264046 GAAGAATTATAGGCCGGGCACGG - Intergenic
1149274319 17:55016716-55016738 TAAGATTTAAATCCCCTGTAAGG + Intronic
1156200116 18:34821385-34821407 GAAGAATCATAGCCTGTGCAGGG + Intronic
1158643900 18:59226811-59226833 GAAGACTGATGGCCCCTTTAGGG + Intronic
1160061901 18:75536810-75536832 GAAAAAGTATTCCCCCTGTATGG + Intergenic
1163900911 19:20099509-20099531 GAAGATTTAAATCCCCTGTTAGG + Intronic
1164857202 19:31534335-31534357 GGAGAACTATAGGCCCAGTATGG - Intergenic
930403503 2:50923032-50923054 GAAGAATTACAAGCCCTGTGGGG - Intronic
930418655 2:51121392-51121414 GCAGCATTATAGCCCCTTTCTGG + Intergenic
931214034 2:60225062-60225084 AAAGGTTTAGAGCCCCTGTAGGG - Intergenic
941166082 2:162084451-162084473 GGAGAATTGTAGCCTCAGTAAGG - Intergenic
941702397 2:168617682-168617704 GAAGAATTAGACACCCTGAACGG + Intronic
943572208 2:189586914-189586936 GAAGAATTAAAGCCTCAGAAAGG - Intergenic
1169649261 20:7848818-7848840 GAAAAATTATATCCCCTGGAAGG + Intergenic
1174752054 20:53121522-53121544 GAAGACTCATAGCCTCTGGAGGG + Intronic
1175523722 20:59619269-59619291 GAAGAATTTTGTCCCCTTTAGGG - Intronic
1177245414 21:18516661-18516683 GAAGAATTAAAGCTCATGTCCGG - Intergenic
1177793370 21:25744862-25744884 GAAGAATTTTAGACCCAGAAAGG - Intronic
1178359562 21:31936934-31936956 GAAGAATGGAAGCCCCTCTAAGG - Intronic
950991707 3:17446291-17446313 GAAGAATTATAGTAGCTTTAAGG + Intronic
952460331 3:33518043-33518065 GAAGAATTCTACCCCATGGAAGG - Intronic
953388620 3:42521552-42521574 GAAGAATTATATCCACGGGAAGG + Intronic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
956418068 3:69053895-69053917 GAATTATTATAGCACCTATATGG + Intergenic
956637277 3:71378827-71378849 GAAAAAACATAGCCCCTATAGGG + Intronic
965240040 3:166185029-166185051 GAAGAATTACAGATCATGTAGGG + Intergenic
969473739 4:7408469-7408491 GATGAATTGAAGCTCCTGTATGG + Intronic
971081693 4:23219911-23219933 GAAGAATTAGAATCTCTGTATGG + Intergenic
971780556 4:31028727-31028749 GAAGAACTGTAGCTCATGTAAGG - Intronic
971900793 4:32655490-32655512 GAAGAATTAGATACCCTGAACGG - Intergenic
979011945 4:115382942-115382964 TAAGAATAATGGCCTCTGTATGG + Intergenic
980172605 4:129307644-129307666 GAAGAATTTTTTCCCTTGTAAGG - Intergenic
983620505 4:169756889-169756911 GAAGAAGTGTAGCCTCTGAAGGG - Intronic
983990206 4:174108780-174108802 GAAGCATTTTAGCTCATGTATGG - Intergenic
991305916 5:65175766-65175788 TAAGATTTAGATCCCCTGTAAGG - Intronic
992298695 5:75354671-75354693 GAGTAATTATAATCCCTGTAAGG - Exonic
993507668 5:88731085-88731107 AAAGAATTGTAGCACCTCTAAGG - Intronic
994539568 5:101077328-101077350 GTAGAACTATAGTCCCTGTCTGG + Intergenic
995683232 5:114743882-114743904 TAACACTTATAGCCCCAGTATGG + Intergenic
997161169 5:131610714-131610736 GAAGAATTATAGCCCCTGTATGG - Intronic
1003290158 6:4773908-4773930 GAAGAATTATAGCCTCAAAAAGG - Intronic
1004355438 6:14926398-14926420 GAAGAAACAGAGCCCCTTTAAGG + Intergenic
1007963448 6:45982204-45982226 CAAGAATCACAGCCCCTGCATGG - Intronic
1011757712 6:90521078-90521100 AAATAATTAAAGCCCTTGTATGG + Intronic
1013022012 6:106230000-106230022 TAAGATTTAAATCCCCTGTAAGG - Intronic
1016318069 6:142811767-142811789 GAAGAATTAAAGGCACTGTTAGG - Intronic
1021336343 7:19407408-19407430 GAAGAATTAAAGCTCCGTTAGGG - Intergenic
1021961043 7:25873246-25873268 GTAGAATTGGAGCCCCAGTAAGG - Intergenic
1032999864 7:137492449-137492471 GATGAATGGTAGCCCCTGCAGGG - Intronic
1033846570 7:145440136-145440158 GAATAATAATAGCTCCTGCAAGG + Intergenic
1042002663 8:64143738-64143760 GAAGAGATATAGCACCTCTAAGG + Intergenic
1047062581 8:121244683-121244705 GAAGAATTATAATCCCTAAAGGG - Intergenic
1053242933 9:36511229-36511251 GAAGAATTATAACAACTGGAAGG + Intergenic
1055457975 9:76490860-76490882 TAAGATTTAGATCCCCTGTAAGG + Intronic
1055783501 9:79845748-79845770 GAACACTTATAGCCACCGTATGG + Intergenic
1058609125 9:106755961-106755983 GAAAAATTCTAGCCACTGTCTGG - Intergenic
1186254274 X:7702109-7702131 TAAGATTTAAATCCCCTGTAAGG + Intergenic
1186941412 X:14512137-14512159 TTAGAATTATGGCCCCTATATGG + Intergenic
1192955617 X:76067374-76067396 AAGGAACTATAGCTCCTGTATGG + Intergenic
1194906642 X:99585175-99585197 GAAGAATTAGAAACCCTGAAAGG + Intergenic
1194907044 X:99590728-99590750 GAAGAATTAGAAACCCTGAAAGG - Intergenic
1196529839 X:116772879-116772901 GAAGAATTAGAAACCCTGAACGG + Intergenic
1196541061 X:116908713-116908735 GAAGAATAATAGCCCTGGGAGGG - Intergenic
1196641348 X:118065828-118065850 GAAGAGTTATAGCTCCTCCAGGG + Intronic
1199021299 X:142881514-142881536 GCAGCATTATAACCCCTGTTGGG + Intergenic
1200848671 Y:7859536-7859558 GAAGAGTTATATCACCTGTGGGG + Intergenic
1202100829 Y:21305783-21305805 GAATATTTCCAGCCCCTGTATGG - Intergenic