ID: 997162497

View in Genome Browser
Species Human (GRCh38)
Location 5:131624047-131624069
Sequence GTGAAGAATCAGAATGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
997162497 Original CRISPR GTGAAGAATCAGAATGTACC AGG Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901696500 1:11012096-11012118 GTGAATACTCAGAAAGTACCTGG + Intergenic
901840705 1:11952322-11952344 GTGAAGAAACGGATTGTACGAGG - Intronic
902090947 1:13902682-13902704 GAGAAGAATGGGAATGTTCCTGG + Intergenic
903686450 1:25135686-25135708 CTGAAGAATCAGAATCTCCGGGG - Intergenic
910239691 1:85073181-85073203 GTGATCAATCAAAATGTACATGG + Intronic
911870214 1:103087692-103087714 CTGAAGGATAAGAATATACCTGG + Intronic
917105864 1:171491275-171491297 GTGAACAATCTGAAGGTACAGGG + Intronic
918424863 1:184398046-184398068 GTGAGGCATCATAATGTAGCGGG + Intronic
920749767 1:208662679-208662701 ATGAAGAATCAGATTGTGCAGGG - Intergenic
1063542877 10:6952133-6952155 ATAAATAATCAGAATATACCTGG + Intergenic
1063545164 10:6974066-6974088 GTGAAGAACCTGACTGCACCCGG + Intergenic
1064918746 10:20492094-20492116 GTAAAGAGTAAGAATGTACCAGG - Intergenic
1066785436 10:38998784-38998806 GTGAAAAATCAGAATCTTCTGGG - Intergenic
1068270695 10:54718988-54719010 GTAAAGAATCAGTGTGGACCGGG - Intronic
1068779710 10:60906420-60906442 TGTAAGATTCAGAATGTACCAGG + Intronic
1068977791 10:63030064-63030086 GTGAACAATCAGAGTGGATCAGG + Intergenic
1069322895 10:67195027-67195049 GGGAAGAATCAAAATGTGTCTGG + Intronic
1069465555 10:68635664-68635686 GTGAAGAATGAGAAGGTAGTAGG + Intronic
1069495531 10:68900655-68900677 GAGAAGGATCACAATGAACCAGG + Intergenic
1069725422 10:70574481-70574503 GTGCAGAGGCAGAATGAACCTGG + Intergenic
1070225533 10:74500338-74500360 GTGAAGATTCTGAATTTTCCTGG + Intronic
1071097530 10:81995792-81995814 ATGAAGAACCAGAAAGTACAAGG - Intronic
1075288565 10:121208724-121208746 GTCAAGAATGAGATTTTACCTGG + Intergenic
1076765970 10:132633287-132633309 GTGAAGCTGCAGAATGTACCGGG - Intronic
1076920369 10:133449715-133449737 GTGAATAATCAGAATATATAAGG + Intergenic
1080939393 11:36898284-36898306 GTCAAAAATCAGAATGAACGTGG + Intergenic
1081046033 11:38274244-38274266 GTGAAGCATCAGAAATAACCTGG - Intergenic
1085534333 11:77208974-77208996 CTGAAGAATCAGAAGATACAAGG - Intronic
1085577057 11:77615075-77615097 GAGAAGATTCAGAGTGTACTTGG - Exonic
1090879776 11:130823483-130823505 GTGAAGGCTCAGAAGGTTCCAGG - Intergenic
1091414520 12:269713-269735 GTGATGAAAAAAAATGTACCTGG + Intergenic
1091433856 12:458962-458984 GTGAAGGATCAAAGTGTTCCTGG - Intergenic
1091788971 12:3260376-3260398 GTGAAGAATTTGGATGTACTTGG + Intronic
1091929450 12:4383120-4383142 GTGGAGAATTAGAATCTCCCAGG - Intergenic
1095365644 12:41401060-41401082 GTGACTAATCATAATGTACCTGG + Intronic
1095728295 12:45475769-45475791 AATAAGAATCAGAATGCACCTGG - Intergenic
1096372013 12:51076631-51076653 GGGCAGAATCCTAATGTACCTGG - Exonic
1096584212 12:52609034-52609056 GTGCAGTATCAGAATGTCCTGGG + Intronic
1098171189 12:67748954-67748976 TTGAAGAATCAGACTGTACAGGG + Intergenic
1098827228 12:75311503-75311525 GAGAAGCATCAGAATATAGCTGG + Intronic
1099877199 12:88422385-88422407 GTTAAGAATAAGAAAGTGCCTGG + Intergenic
1100218638 12:92479996-92480018 GTGATGCATCAGAATGTTCTGGG - Intergenic
1104751297 12:131241075-131241097 GTGAAGAATAAGAAACTTCCAGG - Intergenic
1105974297 13:25459717-25459739 GTGAAGAAAAAGCAAGTACCAGG + Intronic
1108633937 13:52314074-52314096 GTGAATAATCAAAGTGTAACCGG - Intergenic
1109428186 13:62195901-62195923 ATGAAAAATCAAAATGAACCTGG - Intergenic
1109650269 13:65314483-65314505 GGGAAGTATCAGAGTGTCCCTGG - Intergenic
1109729711 13:66396144-66396166 GTTAAGAATCAGAATTATCCTGG + Intronic
1110130172 13:71999456-71999478 GGGAAAAATGAGAATCTACCAGG - Intergenic
1113545567 13:111146516-111146538 ATGCAGAATCAGAATCTCCCTGG + Intronic
1114744696 14:25134849-25134871 GTGAAGAGTCAGGAAGTATCCGG + Intergenic
1116104181 14:40477656-40477678 GTGATGAATTAGAATGTGGCTGG + Intergenic
1116979685 14:51155071-51155093 GTGAAGAACAACAATATACCTGG + Intergenic
1119670309 14:76513466-76513488 GGGAAGAAGCAGAATTGACCTGG - Intergenic
1120642027 14:87026717-87026739 GTGAAGGATCAGCATCTATCTGG + Intergenic
1120783897 14:88512850-88512872 GTGATGCATCAGGAAGTACCAGG - Intronic
1121023851 14:90600040-90600062 TTGAAGAACCAGAATGTCCTGGG + Intronic
1122098074 14:99386166-99386188 GTGAAGGAACACAAAGTACCAGG - Intergenic
1127777591 15:62278592-62278614 TTGAAGAAATAGAATTTACCAGG + Intergenic
1129756037 15:78099733-78099755 GTGAAGAAGCAGAGGGTAGCAGG - Intronic
1130227472 15:82070448-82070470 GTACAGAATCAGAATTTCCCAGG + Intergenic
1131076015 15:89495472-89495494 GTGGAAAATCAGAAAGTACAAGG + Intronic
1133258808 16:4535421-4535443 GGAAAGAATCAGAATGCTCCTGG + Intronic
1133570838 16:7038456-7038478 CTGGAGAATAAAAATGTACCTGG + Intronic
1139686588 16:68608762-68608784 CTGCAGAATAAGAATGGACCAGG + Intergenic
1140269735 16:73454633-73454655 GTGAAGACTTAGAATGGACTGGG - Intergenic
1141613245 16:85195721-85195743 GAGAAGACTCAGGATGCACCAGG + Intergenic
1141670905 16:85491262-85491284 GTGAAGAAACAGATTGATCCTGG - Intergenic
1143848911 17:9794725-9794747 GTGTAGAATTAGAATGTAACAGG + Intronic
1149001885 17:51765783-51765805 GTCAAGAACTAGAAGGTACCAGG + Intronic
1153135757 18:1915968-1915990 GTGAAGAATGAGACTATACTGGG + Intergenic
1153848026 18:9067170-9067192 GTGAATCATCAGAAAGAACCAGG - Intergenic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1156378296 18:36533894-36533916 GTTAAGAATCAGAGTGTGCCAGG + Intronic
1156796250 18:41049745-41049767 GTGAAGAAGAAGAATATTCCAGG - Intergenic
1157031316 18:43911907-43911929 GTTAAAAATCAGATTTTACCTGG + Intergenic
1157410039 18:47455812-47455834 GAGAAGAAACAGGATGTACTAGG + Intergenic
1160060819 18:75527319-75527341 GTGAAGAACCAGAGTGTTCGGGG - Intergenic
1162442410 19:10701260-10701282 GCGAAGAATCAGAATTGAACTGG - Intergenic
1166191150 19:41177639-41177661 GAAAACAATCAGAACGTACCTGG + Intergenic
1167088543 19:47327455-47327477 CTGTAGAGTTAGAATGTACCTGG - Intergenic
1167850102 19:52194770-52194792 ATGAAGAATCAGCGTGTGCCTGG + Intronic
1168402803 19:56095641-56095663 GTGAGGAATCAGAATCGAGCAGG - Intronic
927988949 2:27433673-27433695 GTGAATCAACGGAATGTACCAGG + Exonic
930020661 2:47000116-47000138 TTGAACAACCAAAATGTACCAGG - Intronic
930408755 2:50996837-50996859 GTGAAGAATCCTAATGTAAAGGG - Intronic
930864572 2:56109796-56109818 GGGAAGAATCTGAATGGAGCAGG - Intergenic
933060220 2:77727340-77727362 GTGAATAATCAGAATGTTGAGGG - Intergenic
936386099 2:112030678-112030700 TTCAAGAATCAGAATCTACATGG + Intergenic
936386207 2:112031749-112031771 GTGATGAATGAGAATGAAGCTGG + Intergenic
939483881 2:142784175-142784197 GTAAAGAAGCTCAATGTACCAGG + Intergenic
939493479 2:142902916-142902938 ATTGAGAATCAGAATGTACAGGG + Intronic
942314713 2:174687071-174687093 GTGAAGAATCAGGATGTGTTGGG + Intergenic
942402083 2:175613331-175613353 CTAAAGAAACAGAATGTCCCTGG + Intergenic
942758505 2:179370077-179370099 TTGAAGAAACAGAATTTACTGGG - Intergenic
943998633 2:194804134-194804156 GTGCAAAATCTGATTGTACCTGG - Intergenic
945539140 2:211061825-211061847 GAGAAGAATCAGTAATTACCAGG - Intergenic
947229044 2:227866926-227866948 GGGAAGAATCAGAAGGTACCTGG - Intergenic
947481378 2:230503473-230503495 GAGAATAATCTGAATGTTCCTGG - Intronic
1170560250 20:17551058-17551080 GTGAAGAGTTGGAATGAACCTGG - Intronic
1173136051 20:40440067-40440089 GTGAAGAATTAGAATGAATGGGG + Intergenic
1177344800 21:19854722-19854744 GAGAAGAAACAAAATTTACCAGG + Intergenic
1177871882 21:26583322-26583344 GAGAAGATTCAAAATGAACCTGG - Intergenic
1179790440 21:43753296-43753318 GTGAAGAACTAGGATGTACCTGG - Intronic
1181362845 22:22352182-22352204 GTGAAGAATGAGAATTTTCCAGG - Intergenic
1184281222 22:43438560-43438582 TTGTAGAACCAGAGTGTACCTGG + Intronic
1184355761 22:43978577-43978599 GTGAAGACTCAGAAGGTCCACGG - Intronic
949156407 3:831822-831844 GTTAATAATCAGAATATACAAGG + Intergenic
949668977 3:6376324-6376346 TTGAAGAAGCAGAATTTTCCAGG + Intergenic
950251338 3:11468282-11468304 GTGAAGAATGAGAATGGAAGGGG + Intronic
953100571 3:39821840-39821862 GTGAACAATAACTATGTACCAGG - Intronic
953853889 3:46485929-46485951 CAGAAGAAACAGAATGTACTAGG + Intergenic
957014487 3:75047124-75047146 GTGAAGAATGGGAATGGAGCAGG + Intergenic
961177213 3:124845497-124845519 GTGAAGAATGAGAATGTGGAAGG - Intronic
963276712 3:143338656-143338678 GAAAAGAATCAGAATGGTCCAGG + Intronic
963860981 3:150310104-150310126 CTGAAGCATGAGAATGAACCTGG - Intergenic
966476635 3:180356173-180356195 GTGAAAAATCAGTATGTAGTGGG - Intergenic
966627069 3:182029012-182029034 GTGAATGATTATAATGTACCAGG + Intergenic
967982001 3:195071332-195071354 GTGATGAAGCAGAAGGTACGGGG + Intronic
968041849 3:195595458-195595480 TCAAAGAAACAGAATGTACCAGG - Intergenic
968844441 4:3032186-3032208 GTGAAAAAGCAGAATGGGCCGGG + Intronic
970484603 4:16511962-16511984 GTGAAGAATGAGGGTGTACCTGG + Exonic
971420610 4:26470825-26470847 GTGAAGAATAAGATTTTATCAGG + Intergenic
974675420 4:65081644-65081666 GTGAAGATTGAGAAGGAACCAGG + Intergenic
975959116 4:79879387-79879409 GAGAAGAATCAGAATCTGACAGG + Intergenic
978123873 4:105111850-105111872 AGGAAGAATCAGAATGCACAGGG - Intergenic
978508356 4:109485931-109485953 GTGGAGAATCAGAAGTTACTGGG + Intronic
979156615 4:117400613-117400635 GTGAAAATCCAGAAAGTACCAGG + Intergenic
979741593 4:124158051-124158073 GTGAAGATTTAGAAAGTAACTGG - Intergenic
982410410 4:155070186-155070208 TTGAAGAAACAGCATGAACCTGG + Intergenic
982944035 4:161595668-161595690 CTGATTAATCAGAATGTACAAGG + Intronic
984005357 4:174299287-174299309 GAGAAAAATCAGATTTTACCTGG + Intronic
985687000 5:1287057-1287079 GTGGAGAATCAGAGTGCACCAGG + Intronic
986784330 5:11098166-11098188 GTGAACACTTAAAATGTACCGGG - Intronic
991528783 5:67592819-67592841 GTGAAGAAAAAGAATGTTCTTGG - Intergenic
992022525 5:72638477-72638499 ATAAAGAATCAGAATTTACATGG + Intergenic
993408188 5:87538788-87538810 TTGAAGAAACAGCATGAACCTGG - Intergenic
997015245 5:129925183-129925205 GTAAAGCATAAGAATGAACCTGG + Intronic
997162497 5:131624047-131624069 GTGAAGAATCAGAATGTACCAGG + Intronic
999459142 5:151742701-151742723 GCAAAGAATCAGAATCTACAGGG + Intronic
1001178176 5:169492330-169492352 GTTAATAATCAGAATATATCAGG + Intergenic
1002282104 5:178137142-178137164 GTGAGGAAGCAGCATGTACCAGG + Intronic
1003826252 6:9955615-9955637 GTGAAGAAAGAAAATGGACCGGG - Intronic
1004478165 6:15993735-15993757 GTGTAGAAATAGATTGTACCAGG + Intergenic
1006771878 6:36560520-36560542 GTGAAGAGTCAGAAGGTAGGAGG - Intergenic
1007017956 6:38488390-38488412 GGGAAGAATCAGAATTATCCAGG + Intronic
1007307920 6:40921592-40921614 GTAAAGACTCTGAATGTTCCAGG + Intergenic
1008274802 6:49530461-49530483 GTCAAGAATCAGAATATTACTGG - Intergenic
1012917176 6:105182486-105182508 GAGAAAAATCAGAATGCAGCAGG - Intergenic
1013603405 6:111726080-111726102 GTCAAGAACCTGAATGAACCTGG + Intronic
1015668311 6:135657343-135657365 GTGAACAAAGGGAATGTACCAGG + Intergenic
1017789746 6:157786894-157786916 GGGAAGCATCAGAATGTCCACGG - Intronic
1019769096 7:2872062-2872084 CTGTAGAATCAAAATATACCTGG + Intergenic
1024268666 7:47625878-47625900 GTGAAGAATGAGAGAGGACCGGG + Intergenic
1026675186 7:72422658-72422680 ATGAAGAATAAGAATGAAACAGG - Intronic
1028302870 7:89224108-89224130 GAGATGAGTCAGAATGTCCCTGG - Intronic
1032054451 7:128673222-128673244 GAGAAAAATCAGAGTGTCCCTGG + Intronic
1033227654 7:139573984-139574006 GTGAAGTATCAGGATGCCCCAGG + Intronic
1034374368 7:150629603-150629625 GTGCACAAGCAGAATGTACTTGG - Intronic
1034952964 7:155313360-155313382 CTGAGGAATCAGTGTGTACCCGG - Intergenic
1035122513 7:156580037-156580059 CTGAACAATCAGAATGTTCCAGG + Intergenic
1035839371 8:2794253-2794275 TTGAAAAATCTGCATGTACCTGG + Intergenic
1036113808 8:5935894-5935916 GAGAAGAATTAAAATGTTCCAGG - Intergenic
1037898108 8:22671722-22671744 GGGAAGAATCAGTATTTACAAGG - Intergenic
1038658870 8:29479295-29479317 GAAAAGAAACAGAATGCACCTGG - Intergenic
1039444628 8:37621312-37621334 GTGAAGAATCCTCATGTAACAGG + Intergenic
1043488622 8:80724726-80724748 GTGAAAAATCAGAATGGAGAAGG - Intronic
1045276453 8:100710573-100710595 GTTCAGATTCAGAATCTACCTGG - Intronic
1045319191 8:101068898-101068920 GAGGAGAATTAGAATGCACCTGG - Intergenic
1047164077 8:122417208-122417230 GTCAAGAATCACAAAGTCCCAGG - Intergenic
1052208110 9:25868343-25868365 GAGAAGAATTAGGATGTAACGGG - Intergenic
1052235872 9:26213263-26213285 GTGAAGAAACATAAGCTACCTGG + Intergenic
1053914405 9:42934999-42935021 GTGATGATTTAGAATGTATCTGG + Intergenic
1056600649 9:88044189-88044211 GTGAAGAATCAGGACCCACCTGG - Intergenic
1059941152 9:119361120-119361142 GTGAAGAGTCATAAATTACCCGG - Intronic
1062298894 9:135852752-135852774 TTGAAGAATAAGAATGTGCAGGG - Intronic
1185855048 X:3526111-3526133 CTGAAAAATCAAAATGTAACTGG - Intergenic
1188034216 X:25298451-25298473 TTGAAAAATCAGGATGTAACAGG - Intergenic
1191179262 X:57541587-57541609 GAAAAGAATAAGAATGCACCTGG + Intergenic
1193521772 X:82538779-82538801 GTCAAGAATCATAATGTATATGG - Intergenic
1193973058 X:88081421-88081443 TTGAAGTATCAGCATGTACTAGG + Intergenic
1194380448 X:93183464-93183486 GTTAAGATTCAGTATGTAACTGG + Intergenic
1196558469 X:117119792-117119814 GTGTAGAACCTGAATTTACCAGG - Intergenic
1196916156 X:120537009-120537031 ATGCAGAATCAGAATGTTCCGGG - Exonic
1198986231 X:142457269-142457291 CTGAGCAATCAGTATGTACCAGG - Intergenic
1199016625 X:142823841-142823863 GTAAAGGTTCAAAATGTACCTGG - Intergenic
1199385155 X:147214811-147214833 GAGAAGAGTCAGACAGTACCAGG + Intergenic
1202593333 Y:26510522-26510544 GTGAATAATAAAAATGTAACTGG + Intergenic